ID: 1180754368

View in Genome Browser
Species Human (GRCh38)
Location 22:18150118-18150140
Sequence AGACCAAGGCGGGCCCGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180754353_1180754368 26 Left 1180754353 22:18150069-18150091 CCATTCAGTGGAAAACGAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 22
4: 151
1180754362_1180754368 -7 Left 1180754362 22:18150102-18150124 CCACGAGCGCGGGGCCAGACCAA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 22
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180754368 Original CRISPR AGACCAAGGCGGGCCCGGAG CGG Exonic
900288896 1:1915509-1915531 AGGCCAAAGCGGGCCGGGAAGGG + Intronic
900580252 1:3405190-3405212 AGACCCTGGCGGGCTCGGGGTGG - Intronic
901949142 1:12727504-12727526 AGACCAAGTGGGGCCAGCAGAGG - Exonic
902149207 1:14429247-14429269 AGACCCAGGAGGGCCCTGTGGGG - Intergenic
902228261 1:15010678-15010700 AAAGCAAGACGGGCCGGGAGTGG - Intronic
902337126 1:15759931-15759953 AGAACAAAGCTGGCCGGGAGCGG + Intronic
903672744 1:25046170-25046192 AGACAAAGGAGGGCCTGGGGTGG + Intergenic
904050210 1:27634293-27634315 AGACCGCCGCGGGCGCGGAGGGG + Intronic
904477489 1:30774641-30774663 AGACCCAGGCCCGCCCCGAGGGG + Intergenic
905057325 1:35107139-35107161 AGAACAAGGCCGGCCAGGCGCGG - Intronic
905996043 1:42381099-42381121 TGAGCGAGGCGGGCCCGGGGAGG + Intronic
906073616 1:43035880-43035902 AGAACCAGGCAGGCCCAGAGGGG - Intergenic
906293119 1:44632452-44632474 AGACCCAGGCAAGCCAGGAGCGG - Intronic
907454258 1:54565066-54565088 AGGCCAAGGAGGGCCTGGGGTGG - Intronic
912363352 1:109113097-109113119 AGACCAAAGAGGGCCGGGCGCGG + Intronic
912431600 1:109630971-109630993 ATACCAAGGAAGGCCCTGAGGGG + Exonic
915734723 1:158077539-158077561 AGCCCAAGGCAGGCCCAGGGAGG - Intronic
918194260 1:182207052-182207074 AGGCCAAGGCGGGCCCTGCAAGG - Intergenic
920325655 1:205161293-205161315 AGAGAAAGGCGGGCCAGGCGGGG + Exonic
922933341 1:229407032-229407054 AGACCAGGGCGGGAGGGGAGGGG - Intergenic
924801519 1:247332010-247332032 AGGCCCAGGCGCGCGCGGAGCGG - Intergenic
1064354215 10:14603778-14603800 AGACAAAGCCGGGGCCGGGGAGG - Intronic
1064430579 10:15266959-15266981 AGGCCAAGGCGAGCCAGGAAGGG + Intronic
1067796860 10:49327153-49327175 AGAGCAGGGTGGGCCAGGAGAGG - Exonic
1069470731 10:68687137-68687159 AGGCCAAGGCGGGGGCGGGGGGG - Intronic
1069753747 10:70761092-70761114 AGACCAACAGGGGCCCTGAGAGG - Exonic
1074508973 10:114095799-114095821 AGACCAAGTCTGGCCCTGTGAGG - Intergenic
1076583827 10:131532225-131532247 TGACCAGGGCGGTCCGGGAGAGG - Intergenic
1077179552 11:1206156-1206178 GGACCAAGGTGGGCCAGGAGGGG + Intergenic
1080260691 11:30346765-30346787 AGCCCAATGCAGGCCAGGAGTGG + Intergenic
1082001182 11:47394520-47394542 AGAGGAAGGCGGGCCTGGAGCGG + Intergenic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1087399255 11:97643877-97643899 AGACCAAGGCGGGCGAGGCGAGG - Intergenic
1090264366 11:125344728-125344750 ATTCCAAGGAGGACCCGGAGGGG + Intronic
1096139074 12:49227277-49227299 AAACCAAGGCCGGCCAGGCGCGG + Intronic
1096562859 12:52449454-52449476 AGACAAAGGTGAGCACGGAGTGG - Exonic
1096565008 12:52471117-52471139 AGACCAAGGTGAGCAGGGAGTGG - Exonic
1096567021 12:52490554-52490576 AGACCAAGGTGAGCAGGGAGTGG - Exonic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1099014140 12:77324991-77325013 AGAGCGAGCCGGGCCGGGAGAGG + Intergenic
1102187995 12:110964847-110964869 AGCCCAAAGCGGACCCCGAGTGG + Intergenic
1103001860 12:117390869-117390891 AGACCAAGGTTGGCCAGGCGTGG - Intronic
1104894231 12:132153959-132153981 AGCCCAAGGAGGGCGGGGAGGGG - Intergenic
1106264866 13:28100682-28100704 GGACCGAGGCGGGAGCGGAGAGG + Intergenic
1112243684 13:97707854-97707876 AGATCAAGATGGGCCAGGAGCGG + Intergenic
1113789021 13:113017566-113017588 AGTCCAAGGCGGCCCCTGAAAGG - Intronic
1113882475 13:113635397-113635419 AGACCCAGGGTGGCCGGGAGAGG + Intronic
1115854059 14:37611089-37611111 AGTCCGAGGCTGCCCCGGAGCGG + Intronic
1116157688 14:41228714-41228736 AGGCCAAGGCGGGGCGGGGGGGG - Intergenic
1119555101 14:75546939-75546961 AGAGCAAGGCGGGCAGGGAACGG + Exonic
1120906486 14:89625400-89625422 AGACAAAGGGGGGTCTGGAGAGG - Intergenic
1122200052 14:100117035-100117057 GGACCAAGGGAGGCCTGGAGGGG + Intronic
1123210502 14:106755813-106755835 AGACCAAGGCCTCCCCTGAGGGG + Intergenic
1124190795 15:27574627-27574649 AGACCAAGGAGGGGAAGGAGGGG - Intergenic
1124800031 15:32823487-32823509 ACACCAAGGTGGGCCCAAAGAGG + Intronic
1125536246 15:40442189-40442211 GGACAAAGGCGGCGCCGGAGCGG + Intronic
1128986907 15:72228948-72228970 AGACAAAGGCAGGCAAGGAGGGG - Intronic
1130550788 15:84888878-84888900 AGACAAGGGCGGGCCTGGGGTGG + Intronic
1130992084 15:88881612-88881634 AGACCAGGGCCGGCTCGTAGCGG + Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132502989 16:292868-292890 AGACCAAGGAGGGCGCAGTGAGG + Intronic
1134194519 16:12148990-12149012 AGACGAAGGCAGGCCGGGCGTGG - Intronic
1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG + Intergenic
1136995377 16:35185417-35185439 AGACCACAGCAGGCCCTGAGTGG - Intergenic
1137020840 16:35425571-35425593 CGACCAAGGCGGGACTGGAGCGG + Intergenic
1139956450 16:70695487-70695509 AGTCCAAGGCTGCCCTGGAGTGG - Intronic
1142168562 16:88607183-88607205 AGACCCAGGCACGCCCAGAGAGG - Intronic
1142230813 16:88899498-88899520 ACCCCAAGGCGGGCTGGGAGTGG + Intronic
1142409942 16:89910886-89910908 AGACCAAGCCAGGCACAGAGTGG - Intronic
1142506196 17:364772-364794 AGACCAGGGAGGGCCGGGAGTGG - Intronic
1142856949 17:2736137-2736159 AGAGAAAGGCGGGCCGGGCGCGG + Intergenic
1143165074 17:4893550-4893572 AGGCGAAGGCGGGCCAGCAGAGG + Exonic
1145004591 17:19330168-19330190 GGGCCAAGGTGGGCCTGGAGGGG + Intronic
1146166469 17:30593646-30593668 AGACCAAGGCGGGGGCGGGGGGG + Intergenic
1147659438 17:42109515-42109537 AGAACAAGACGGGCACAGAGAGG - Intronic
1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG + Intergenic
1152650055 17:81488507-81488529 AGACCAAGGCAGGGCCAGAGGGG - Intergenic
1152742200 17:82023287-82023309 AGAACAAGGCGCGCCGGGAGAGG - Exonic
1152793143 17:82292980-82293002 AGACCCAGGAGGGCCCGGCCAGG + Intergenic
1152930931 17:83109549-83109571 AGGCCAGGCCAGGCCCGGAGAGG - Intergenic
1155268684 18:24118468-24118490 GGACCAAGCCAGGCCCAGAGGGG - Intronic
1160006379 18:75072070-75072092 AGGGCCAGGCGGGCCCGGCGAGG - Intergenic
1160450031 18:78956617-78956639 AGAACAAGGCTGGCCAGGTGCGG - Intergenic
1161563904 19:4988896-4988918 AGACCCAGGCTGGACGGGAGGGG - Intronic
1161738121 19:6004186-6004208 AGACCAAGGTGCGTCCGGGGTGG - Exonic
1163216151 19:15879128-15879150 AGACCAAGGTGGGGTAGGAGGGG + Intronic
1165307222 19:35010188-35010210 AGACCACGGTGAGCCCGCAGCGG + Exonic
1167146250 19:47682014-47682036 TGACCGAGGCAGGCACGGAGAGG - Exonic
1167199735 19:48056255-48056277 AGATCAATGCGGGCCAGGCGTGG + Intronic
1167646088 19:50705864-50705886 AGCCCAAGGTGGGCCAGGGGTGG + Intronic
1168323791 19:55526459-55526481 AGGCCAAGGAGGGCGCGGAGAGG + Intergenic
926202416 2:10811703-10811725 TGACCAAGGCGAGCCCGGCAAGG + Intronic
928283241 2:29966722-29966744 AGACCAAGGCAGGGCAGGACTGG - Intergenic
928848451 2:35709916-35709938 AGAGCAAAGCGGGCGGGGAGGGG + Intergenic
934993370 2:98936473-98936495 AGGCCGAGGCGGGTCGGGAGCGG - Intergenic
938023760 2:127927096-127927118 AGCCAGAGGCAGGCCCGGAGCGG + Intergenic
942431670 2:175918154-175918176 AGGCCAAGTCTGGCCCAGAGTGG - Intergenic
947418411 2:229921509-229921531 GGACCAAGGGGGGCCGGAAGTGG - Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948388961 2:237598429-237598451 AGAACAAGGCAGGCACGGGGAGG - Intronic
948983585 2:241507553-241507575 AGACCCTGGCGGGCGCTGAGGGG - Intronic
1173872962 20:46353029-46353051 AGACCAAGGAGTTCCCTGAGTGG - Intronic
1175099995 20:56572428-56572450 AGAACAAGGCTGGCCGGGTGTGG + Intergenic
1175238152 20:57526786-57526808 AGACCTAGGCGGGGCAGGGGTGG + Intergenic
1175766199 20:61594401-61594423 AGACCCAGGTGGGCCCGGTGGGG - Intronic
1178375898 21:32067342-32067364 AGACCAAGACAGGCCCCGACTGG - Intergenic
1179951673 21:44711988-44712010 CGACCATGGCAGGCCGGGAGCGG + Intergenic
1180036418 21:45252616-45252638 AGGCCATGGCGGGTCCAGAGGGG - Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1181516106 22:23414746-23414768 AGCCCAAGGAGGTCCTGGAGGGG + Intergenic
1182257051 22:29046780-29046802 AGAGCAAGGGGCGCCGGGAGGGG + Exonic
1182279767 22:29211171-29211193 AGACCAAAGCAGGCCCAGAGGGG - Intronic
1182516846 22:30863884-30863906 AGACCAGGCAGGGCCCTGAGGGG - Intronic
1184369049 22:44070991-44071013 AGGCCAAGGCGGGCGGGCAGGGG - Intronic
1185219337 22:49621726-49621748 AGACCAAGGGCTGCCAGGAGCGG + Intronic
949614507 3:5738854-5738876 TGACCAAGGTGGGCTTGGAGAGG + Intergenic
950007912 3:9703536-9703558 AGACCTAGGCAGGCTGGGAGTGG + Intergenic
950091322 3:10297139-10297161 AGACCAAGGCAGGCCGGGCGCGG - Intronic
954753448 3:52826526-52826548 AGACCAAGGTGGGCCTGTTGTGG - Exonic
963272015 3:143294584-143294606 AGACAAAGGAGGGCCTGGAGGGG + Intronic
963503770 3:146160743-146160765 AGACCCCGGCGGTCCTGGAGAGG + Intronic
965390198 3:168095407-168095429 ACACAAAAGCCGGCCCGGAGGGG + Exonic
968413294 4:407252-407274 AGAATAAGGCGGGCCGGGCGCGG + Intergenic
969002906 4:3996513-3996535 AGACCAAGGGCTGCCGGGAGTGG + Intergenic
969096242 4:4734959-4734981 AGATCAAGGGAAGCCCGGAGAGG + Intergenic
969811032 4:9648306-9648328 AGACCAAGGGCTGCCGGGAGCGG - Intergenic
971757734 4:30722772-30722794 AGACCAAGGCGAGAACGGGGTGG + Exonic
972221984 4:36966491-36966513 AGGCCAAGGAGGACCCTGAGGGG - Intergenic
973854136 4:54993746-54993768 AGCCCACGGCGGGCCGGGGGAGG - Intergenic
983632109 4:169859963-169859985 GGACCCAGGAGGGCCAGGAGAGG + Intergenic
999751880 5:154633620-154633642 AGAGCAAGGCGGGCCAGGTGTGG - Intergenic
1001083456 5:168683745-168683767 AGAGGAAGGCAGGCCCGCAGAGG - Intronic
1001264309 5:170261605-170261627 ACACCAAGGTGGGCCCTGAGAGG - Intronic
1006179866 6:32148421-32148443 AGAACAAGGCGGGGCCGCCGAGG + Exonic
1007346578 6:41235964-41235986 AGAGCTAGGCAGGCCAGGAGTGG + Intronic
1012381630 6:98626535-98626557 AGACCAAGGCTGGCCTAGAAGGG + Intergenic
1012850258 6:104438080-104438102 ATACAAAGGCGGGCCAGGCGCGG - Intergenic
1013066323 6:106687508-106687530 ATACCAAGGCGGGCCCCCACTGG - Intergenic
1015881905 6:137878710-137878732 ACTCCAAGCCGGGCCCTGAGGGG + Exonic
1017807918 6:157962387-157962409 AGACAAAGTCAGGCCCGGTGCGG + Intergenic
1018246681 6:161830540-161830562 AAACAAAGGCGGGCCGGGTGCGG - Intronic
1018915274 6:168129092-168129114 AGGCCTAGGCGGGGCCGGAGAGG - Intergenic
1019404661 7:877178-877200 AGACCAAGGTGGGGCGGGGGAGG - Intronic
1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG + Intronic
1019595113 7:1854805-1854827 AGACAAAGGCAGGACAGGAGGGG + Intronic
1019695611 7:2444506-2444528 GGAACAAGGCAGGCCAGGAGGGG - Intergenic
1021845261 7:24757330-24757352 AGACCAAAGAGGATCCGGAGTGG + Intronic
1023810158 7:43906001-43906023 CGACCAAGGAGATCCCGGAGCGG + Intronic
1026870305 7:73847025-73847047 AGCCCAAGGCAGGCCAGGTGTGG + Intergenic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1031836909 7:126690270-126690292 AGGGCAAGGCAGGCACGGAGTGG + Intronic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1033148353 7:138890969-138890991 AGATGAAGGCGGGCCCAGTGGGG - Intronic
1033654241 7:143362461-143362483 AGGGCAAGGCGGGTGCGGAGCGG + Intronic
1034441163 7:151086703-151086725 GGCCCGAGGCGGGCCCGGGGCGG - Intronic
1034960083 7:155359518-155359540 ACACCAAGGCAGGCCCGGGGAGG + Intronic
1037580658 8:20244310-20244332 AGCACAAGGCGGGCCAGGTGCGG - Intergenic
1039612151 8:38928537-38928559 AGACCAGGTCGGGCCGGGCGCGG - Intronic
1041269477 8:56097473-56097495 AGAGTAAGGCGGGCCGGGCGTGG + Intergenic
1045506130 8:102780023-102780045 AGACTAATGCGGGCCCCGCGCGG + Intergenic
1048484191 8:134832065-134832087 AGCCCGAGGCGCGCCTGGAGCGG + Intergenic
1049014239 8:139908306-139908328 AGAGCAAGGCGGTCCTGGATGGG - Intronic
1049665468 8:143840886-143840908 AGGCCAGGGCGGGCCGGGAGAGG - Exonic
1049746949 8:144267042-144267064 GGAAGAAGGCGGGCCCGGAGTGG - Exonic
1053073555 9:35115064-35115086 AGACCAAGGCCGGCTCTGGGAGG + Intronic
1055055246 9:72017687-72017709 AGAACAAGTGGGGCCGGGAGCGG - Intergenic
1055962925 9:81837299-81837321 AAACCAATGTGGGCCGGGAGTGG + Intergenic
1056546771 9:87620183-87620205 AGACCAAGGAGGGGCACGAGCGG - Intronic
1060826256 9:126689691-126689713 AGACAAACGAGGGCCGGGAGAGG - Intronic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1190167539 X:48085477-48085499 AGAGCATGGCGGGCCAGGGGTGG + Intergenic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1200887399 Y:8282591-8282613 AGACCTAGACGGGCCTTGAGGGG - Intergenic