ID: 1180756031

View in Genome Browser
Species Human (GRCh38)
Location 22:18161855-18161877
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 2, 1: 0, 2: 6, 3: 50, 4: 433}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180756027_1180756031 -1 Left 1180756027 22:18161833-18161855 CCTTTCCAGATGCTTCTGCTGCT 0: 2
1: 0
2: 4
3: 49
4: 506
Right 1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG 0: 2
1: 0
2: 6
3: 50
4: 433
1180756029_1180756031 -6 Left 1180756029 22:18161838-18161860 CCAGATGCTTCTGCTGCTGGAGA 0: 2
1: 0
2: 5
3: 38
4: 377
Right 1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG 0: 2
1: 0
2: 6
3: 50
4: 433
1180756026_1180756031 0 Left 1180756026 22:18161832-18161854 CCCTTTCCAGATGCTTCTGCTGC 0: 2
1: 0
2: 5
3: 39
4: 500
Right 1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG 0: 2
1: 0
2: 6
3: 50
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900081002 1:857460-857482 TGGAGAAAATGCAGAACAAGTGG + Intergenic
900159979 1:1218893-1218915 TGGAGAACCTGAAGGACCGCTGG - Exonic
900341191 1:2190121-2190143 CGGAGAAAAGGCAGGACGGCGGG + Intronic
901425494 1:9180272-9180294 TGGAGAAATTGCAAGAAAGCGGG - Intergenic
901718618 1:11176937-11176959 TGTAGAAGAGAAAGGACAGCAGG + Intronic
901987812 1:13090168-13090190 TGAGAAAGAAGCAGGACAGCTGG - Intergenic
901994000 1:13136599-13136621 TGAGAAAGAAGCAGGACAGCTGG + Intergenic
902673141 1:17989314-17989336 TGGAGAAGATGCAGAGCAACTGG - Intergenic
902792182 1:18776943-18776965 TGGAGAGGGGGCAGGACAGAGGG - Intergenic
903480351 1:23648572-23648594 TGATGAAGATGCAGGAAAACAGG - Intergenic
904005722 1:27362189-27362211 TGGAGAAGATGCAGTATTACTGG - Exonic
904082813 1:27882616-27882638 TGGAGGAGATGAGTGACAGCCGG + Exonic
904271304 1:29351993-29352015 TGGAGAATATGCTGCACACCAGG + Intergenic
904341597 1:29838403-29838425 TGGAGAGGAGCAAGGACAGCTGG - Intergenic
904925825 1:34047450-34047472 AGGAGAAAATGCAGGACAAGGGG - Intronic
905077189 1:35282932-35282954 TGGTGAGGATGCAGAAAAGCTGG - Intronic
905144485 1:35877084-35877106 TAGAGAAGATGCAGGAAAATAGG + Intronic
906017574 1:42595802-42595824 TGGACAAGGTGCATGATAGCAGG - Intronic
906288092 1:44601465-44601487 AGGAGAAGATGCAGTAGAGAGGG + Intronic
906952576 1:50346888-50346910 GGGAGAGGAGGCAGCACAGCCGG + Intergenic
907023422 1:51091004-51091026 TGGAAACTATGCAGGACAGTAGG + Intergenic
907512688 1:54973476-54973498 TGGGGAAGCTGCATGCCAGCGGG - Intergenic
907559431 1:55375153-55375175 TGTAGAAGATGAAGTTCAGCAGG + Intergenic
908058187 1:60315513-60315535 TACAGAAGATTCAGTACAGCAGG - Intergenic
908311216 1:62886452-62886474 AGGAGAAAAACCAGGACAGCAGG - Intergenic
908482048 1:64550635-64550657 TGGAGAAAGTGAAGTACAGCAGG + Exonic
908679340 1:66642190-66642212 TGGAGAAGAAGCTGCACAGCGGG - Intronic
908861005 1:68489590-68489612 TGGCGAAGTTGCAGGAAATCTGG + Exonic
910107192 1:83644461-83644483 GGGAGATGATGCTGGAGAGCTGG + Intergenic
911043798 1:93612366-93612388 TGCACAAGCTGAAGGACAGCTGG + Intronic
915037690 1:152942547-152942569 AGGAGAAGCAGCAGGGCAGCTGG - Intergenic
915718587 1:157966783-157966805 GGGGGAATATCCAGGACAGCTGG + Intergenic
915740609 1:158115896-158115918 TGGAGGAGATTCAGCACAGGAGG - Intergenic
916337467 1:163689604-163689626 TGGTGAGGATGCAGAACAGCAGG + Intergenic
916470137 1:165115924-165115946 AGGAGAAGATGAAGAGCAGCAGG - Intergenic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
917552973 1:176054727-176054749 TGGAAAAGATCCAGGATAGATGG - Intronic
920526227 1:206668691-206668713 TCAGGAAGAGGCAGGACAGCAGG + Intronic
920564990 1:206965997-206966019 GGGAGAAGCTGCAGGAGGGCAGG - Intronic
921096000 1:211887853-211887875 TGGAGAAGAGTGAGGCCAGCTGG - Intergenic
921171692 1:212555610-212555632 TTGAGAGGATACAGCACAGCAGG - Intergenic
921540518 1:216408848-216408870 TGGAGAAGCTGCTGGACAAAGGG + Intronic
921598578 1:217082086-217082108 TGAAGTAGTTGCAGGGCAGCTGG - Intronic
923800730 1:237205887-237205909 TTGGCAAGATGCAGGACAACTGG + Intronic
1063344601 10:5299258-5299280 AGCAGGAGATGCAGGAAAGCTGG - Intergenic
1064406352 10:15067697-15067719 AGGAGAAGGTGCAGGAGGGCAGG - Intronic
1064485309 10:15782415-15782437 TGAAGAAGATGCTGGAAAGTAGG + Intronic
1064916638 10:20465679-20465701 GAGAGTAGATGCAGGACAGTGGG - Intergenic
1066276635 10:33875372-33875394 TTCAGAAGATGCAAGACAGGGGG - Intergenic
1068346559 10:55787464-55787486 GGGAGAAGATACAGGACCCCTGG + Intergenic
1068525389 10:58123203-58123225 TGGACAAGATGCAAAACAGATGG + Intergenic
1068926340 10:62543263-62543285 AGGGGAAGATGTAGGTCAGCAGG + Intronic
1070364112 10:75719377-75719399 TGGTTAAGATGGAGAACAGCTGG - Intronic
1071008206 10:80908141-80908163 TTGACAATTTGCAGGACAGCAGG - Intergenic
1072906239 10:99456676-99456698 GGGACAAGATGCCGGAGAGCAGG - Intergenic
1072930859 10:99660461-99660483 GGGGAAAGATGCAGAACAGCAGG + Intronic
1074813533 10:117127422-117127444 GGGAGAAGAGGCAGGAATGCAGG - Intergenic
1075028434 10:119004064-119004086 TGGAGAAGTTAAAGGACAGCTGG + Intergenic
1075644925 10:124091339-124091361 GGGAGGAGAAGCAGGAAAGCGGG + Intronic
1076028178 10:127134498-127134520 AGGAGCAGATGCAGGACTACAGG + Intronic
1077246527 11:1541978-1542000 GGGAGCAGGAGCAGGACAGCAGG - Intergenic
1077798810 11:5518059-5518081 TGCAGAAGCTGCAGGGCAGCTGG - Intronic
1078524983 11:12093599-12093621 CGGAGAAGATTCATGAAAGCTGG + Intergenic
1078605763 11:12774134-12774156 AGGAGAGGAGGCAGGACAGGAGG + Intronic
1079294054 11:19216224-19216246 TGGTGAAGATGCAGAGCAACTGG - Intergenic
1079393061 11:20039024-20039046 AGGAGCTGATGCTGGACAGCTGG - Intronic
1079603722 11:22341533-22341555 TGGAGAAGAAGCAAGACACCGGG + Exonic
1080641108 11:34158899-34158921 TTGTGAAGATGCAGGAGGGCTGG + Intronic
1081555096 11:44151849-44151871 TGGTGAAGATGTAGGGCAACAGG - Intronic
1081690706 11:45075925-45075947 TGGAGAAGATGACGGTCAGTGGG + Intergenic
1083100070 11:60294091-60294113 TGGAGATTTTGCAGAACAGCAGG - Intronic
1083115696 11:60457218-60457240 TTGAGAAGATTCAGGAAAGAAGG + Intronic
1083827369 11:65211233-65211255 GGGAGAACAGGCAGGTCAGCTGG - Intronic
1084336052 11:68458595-68458617 TAGAAAAGATCCAGTACAGCTGG + Intergenic
1084949369 11:72656301-72656323 TGGATAAGTTCCAGCACAGCAGG + Intronic
1085108116 11:73863287-73863309 TTGAGCATATGCAGGCCAGCAGG - Intronic
1085366353 11:75949249-75949271 GGGAGAAGCAGAAGGACAGCTGG - Intronic
1086641659 11:89165720-89165742 TGTAGAAGAAGCTGGAGAGCAGG - Intergenic
1086754227 11:90538719-90538741 TGGGGAGGATACAGCACAGCAGG - Intergenic
1087795760 11:102453298-102453320 TGGAGAAGATGAAGTACAACTGG - Intronic
1088315039 11:108498506-108498528 GGGAGACGAGGCGGGACAGCGGG - Intergenic
1089100795 11:115960866-115960888 AGGAGAAGGTGCAGGAGAGAAGG - Intergenic
1089397349 11:118145122-118145144 TGGAGAAGGTGCAGGGCAGCAGG + Exonic
1089864462 11:121619802-121619824 TGAAGATGATCCCGGACAGCAGG + Exonic
1090050713 11:123376402-123376424 CGGAGAAGAGGCAGTACACCTGG - Intergenic
1090864151 11:130681691-130681713 TGGAGAAAATCCAGAACAGTGGG + Intronic
1090886710 11:130883544-130883566 TGGAGAAGAATAAGGAAAGCTGG - Intronic
1090904739 11:131065419-131065441 TGGACAAGATGAGGTACAGCAGG - Intergenic
1091705602 12:2691156-2691178 AGGAGGAGCTCCAGGACAGCAGG + Exonic
1091770321 12:3147224-3147246 TGGAGGAGCTGCTGGGCAGCAGG + Intronic
1092099152 12:5869047-5869069 TGGAGCAGATGGAAGACAGGTGG + Intronic
1092227566 12:6757907-6757929 TGGAGAACAGGCAGGCAAGCTGG + Intronic
1092839123 12:12522035-12522057 GAGAGAAGATGCAGGAAAACTGG + Intronic
1095166047 12:38973344-38973366 TGGTGAGGATGCAGGACAATAGG - Intergenic
1095359590 12:41320091-41320113 TGCAGAAGATGGATAACAGCAGG - Intronic
1095406164 12:41869672-41869694 TGGAGAAAAGGCAGGAATGCAGG - Intergenic
1096492535 12:52020639-52020661 AGGAGAAGAGGAAGGACAGCAGG + Intergenic
1096547166 12:52348044-52348066 TGGTGAAGATGGACAACAGCTGG + Intergenic
1097502911 12:60428487-60428509 TGGAGAAGTAACAGGACAGAAGG - Intergenic
1097710281 12:62910133-62910155 TGGAGAAGAAACATGACAGCAGG + Intronic
1099771112 12:87057980-87058002 TGGTGCAGATGAAGAACAGCTGG + Intergenic
1099882773 12:88488417-88488439 TAGCCAAGATGAAGGACAGCAGG + Intergenic
1100498302 12:95146432-95146454 CGGTGAGGATGCAAGACAGCAGG + Intronic
1100897672 12:99202903-99202925 TGGAGAGGATGTAGGACACTTGG - Intronic
1104160627 12:126176794-126176816 TGGAAAAGATGCAGAGCAACAGG - Intergenic
1104629792 12:130390876-130390898 TGGAGAAGAAGCTGCCCAGCAGG - Intergenic
1104632743 12:130418053-130418075 TGCAGAAGAGACAGGACAGGTGG + Intronic
1104678129 12:130729525-130729547 CAGAGTGGATGCAGGACAGCAGG + Intergenic
1106835507 13:33630353-33630375 TGGTGAAGAGGTAGGAAAGCTGG - Intergenic
1108071094 13:46629453-46629475 TTGAAAAGATGCAGAGCAGCTGG + Intronic
1108812250 13:54241965-54241987 TGTAGAGGATGAATGACAGCAGG + Intergenic
1109471154 13:62805895-62805917 TGGTGAAGATGCAAAACAACAGG + Intergenic
1109745006 13:66613359-66613381 TGGAGAAGAGGCAAGACAAAAGG - Intronic
1109883020 13:68506829-68506851 GGGAGAAGAGGCTGGACATCAGG + Intergenic
1110498563 13:76198749-76198771 TGGAGAATACACATGACAGCAGG - Intergenic
1110587294 13:77208933-77208955 TGAAGCAGATGCAGGCCAGAAGG + Intronic
1110648178 13:77913775-77913797 TGGATAAAAAGCAAGACAGCCGG - Intronic
1112307257 13:98286224-98286246 AGGAGCAGATGCAGGAGAGAGGG - Intronic
1113273843 13:108706539-108706561 TGGAGAAGACGGAGGACAAAAGG - Intronic
1113447416 13:110379924-110379946 TGGAGAAGGTGGAGGAGAGGAGG - Intronic
1114260369 14:21032219-21032241 GGGAGAAGAGGCAGCACAGGAGG + Intronic
1114397304 14:22377330-22377352 GGGAGAAAAGGCTGGACAGCAGG - Intergenic
1114429005 14:22644565-22644587 TGGAGAGGGTGCAGGAAAGATGG - Intergenic
1114673129 14:24423635-24423657 TGGGGAAGATGAGGGGCAGCTGG + Intergenic
1114702037 14:24688470-24688492 GTGAGAAGATGGAGGACAGCAGG - Intergenic
1118412819 14:65500527-65500549 TAGAGATGATGGTGGACAGCTGG + Intronic
1118751012 14:68807985-68808007 TGAAGATGATGAAGGACAGATGG + Intergenic
1119648138 14:76363443-76363465 TGGAGAAGATGAAGGGCAGCCGG - Intronic
1119773828 14:77236648-77236670 TGAAGTAGAAGAAGGACAGCAGG - Exonic
1119898754 14:78242711-78242733 AGGAGAAGGTGCAGGAGAGTAGG - Intronic
1120866387 14:89299006-89299028 TGGAGAACTGGCAGGACAGTTGG - Intronic
1121423869 14:93834462-93834484 TGGATCAGTTTCAGGACAGCAGG - Intergenic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1122150469 14:99723039-99723061 TGGAGATGATGAAGAACAGCAGG - Intronic
1122503758 14:102218840-102218862 TGCACCAGAAGCAGGACAGCTGG - Intronic
1122867439 14:104613651-104613673 TGTAGAAGAGCCAGGCCAGCAGG + Intergenic
1122878566 14:104679760-104679782 TAGAGAAGAGCCAGGACATCTGG - Intergenic
1202852753 14_GL000225v1_random:31320-31342 TGGAGGAGATTCAGGACCCCGGG + Intergenic
1124210320 15:27758101-27758123 TGAAGAAGAGGCAGATCAGCTGG + Intronic
1124356450 15:28998754-28998776 GGGATGTGATGCAGGACAGCTGG + Intronic
1124359381 15:29024539-29024561 GGGATTTGATGCAGGACAGCTGG - Intronic
1124403268 15:29369391-29369413 TAGAAAACATGCAGGACAGGAGG + Intronic
1125953947 15:43776682-43776704 TGGAGAAGGTGCAGGGGAGAGGG - Intronic
1126097416 15:45099402-45099424 TGGGGAATATGCAGGCCAGCAGG + Exonic
1126117202 15:45219045-45219067 TTAACAAGCTGCAGGACAGCCGG - Intergenic
1126579911 15:50233187-50233209 TGGAGAGGATGTGGGACAGGAGG - Intronic
1127279894 15:57479837-57479859 TGGAGAGGAAGCAGGGAAGCTGG + Intronic
1127438250 15:58979593-58979615 TTGAGAAGAACCAGAACAGCTGG - Intronic
1128335921 15:66785768-66785790 AGGAGAGGAGGCAGGACGGCAGG - Intergenic
1129014144 15:72450973-72450995 TGGTGAAGATGCAAGGAAGCTGG - Intergenic
1129235456 15:74221275-74221297 TGGAGCAGGGGCAGGAGAGCAGG + Intergenic
1130108633 15:80947419-80947441 TGAAGAAGATGCAGGACCCCTGG - Intronic
1130160691 15:81396998-81397020 TGGAGAAGATGCCGAACCACTGG + Intergenic
1130276166 15:82477385-82477407 TGGAGAAGCTGCAGGTGAGTAGG - Intergenic
1130468525 15:84204778-84204800 TGGAGAAGCTGCAGGTGAGTAGG - Intergenic
1130495739 15:84468764-84468786 TGGAGAAGCTGCAGGTGAGTAGG + Intergenic
1130590818 15:85209377-85209399 TGGAGAAGCTGCAGGTGAGTAGG - Intergenic
1130787187 15:87113103-87113125 TAGAGAGGATGCAGAGCAGCAGG + Intergenic
1131058774 15:89391775-89391797 GGGAGAAGAGGCAGGGCAGCAGG + Intergenic
1131101792 15:89696920-89696942 TGGTGAAGATGCAGAGCAACTGG - Intronic
1131382316 15:91974177-91974199 AGGATAAGAACCAGGACAGCAGG + Intronic
1131686968 15:94778765-94778787 TGGAGAAGGTCCCGGACTGCAGG + Intergenic
1131789239 15:95946409-95946431 TGGAAAAGAGGAAGGGCAGCTGG + Intergenic
1131899724 15:97074290-97074312 TGGATAAGAGGCAGGAAAGAGGG - Intergenic
1132637426 16:958943-958965 TGCAGAAGGTTCGGGACAGCAGG + Intronic
1132948040 16:2543464-2543486 AGGGGAAGATGCAGGAGTGCTGG - Intronic
1132966407 16:2657878-2657900 AGGGGAAGATGCAGGAGTGCTGG + Intergenic
1133425986 16:5690039-5690061 TGGTGAAGCTGAAGGAGAGCTGG + Intergenic
1133827559 16:9291799-9291821 TGGAGAGGATGCAGGACACACGG - Intergenic
1133853135 16:9524749-9524771 TGGAAAGGATACAGGAAAGCAGG - Intergenic
1134074552 16:11281422-11281444 TGGACATGATGCAGGCCACCTGG - Intronic
1134311458 16:13078846-13078868 TGGAGATGCTGCAGGGCAGTGGG + Intronic
1134413856 16:14026908-14026930 TGGAGAGGATGTAGAACAACTGG + Intergenic
1135599479 16:23769762-23769784 TGGAGAAGCTGAAGGAGACCTGG + Intergenic
1136560794 16:31038144-31038166 TGGAGCAGATGCTGGACAGTGGG + Exonic
1137358242 16:47787370-47787392 TGGAGAAAATAGGGGACAGCCGG - Intergenic
1138535584 16:57658590-57658612 TGGTGATGAGGAAGGACAGCTGG + Intronic
1139546693 16:67653062-67653084 GGGAGAAGATGCAGAGCCGCAGG + Exonic
1140551559 16:75871316-75871338 AGGAGAAGAAACAGGACAGTGGG + Intergenic
1141831366 16:86511463-86511485 TGGAGAGGCTGCCGGACAGGGGG - Exonic
1142030869 16:87837892-87837914 TGGAGAGGATGGAGGGCAGGTGG + Exonic
1142305727 16:89283863-89283885 AGGAGAGGAGGCGGGACAGCCGG - Exonic
1142313456 16:89328205-89328227 TGGAGAGGATGTAGAAAAGCTGG + Intronic
1142961096 17:3553053-3553075 AGGAGAAGATCCAGGTCAGGAGG - Intronic
1143033396 17:3980721-3980743 TGGAGCAGCTGAAGGAGAGCTGG + Intergenic
1143103712 17:4518102-4518124 AGGAGAAGAGGCTGGACAGTGGG + Intronic
1143313124 17:6009998-6010020 TGGAGCAGAAGAGGGACAGCAGG - Intronic
1143591122 17:7886161-7886183 TGGTCAAGCTGCAGAACAGCTGG - Intronic
1144523419 17:15969487-15969509 TAGAGAAGATGCAGGAAAAAGGG - Intronic
1145250348 17:21293858-21293880 TGGAGAGGATGCAGGACAAGGGG - Intronic
1145410071 17:22652184-22652206 AGGAGAAGATACAGGACCCCTGG + Intergenic
1146978424 17:37136599-37136621 TGATGAGGATGCAGGACAGCTGG - Intronic
1147994135 17:44352112-44352134 TGGAGAAGATGCCTGCCCGCCGG + Exonic
1148370662 17:47097489-47097511 TGGATAAAAAGCAAGACAGCTGG + Intergenic
1148600774 17:48892775-48892797 TGGAGAAGGTCCAGGACACGTGG + Intronic
1149633821 17:58149858-58149880 TGGAGAAGAAGAAGCAGAGCTGG - Intergenic
1150357200 17:64496878-64496900 TCGAGTAGATGCGGGGCAGCCGG - Exonic
1150467032 17:65402802-65402824 TGGAGATGCTGGAGGACAGATGG + Intergenic
1150645736 17:66976475-66976497 TGGAGAGGATAGAGGAAAGCTGG - Intronic
1150909458 17:69372753-69372775 TCGAGAAGATTCAGGACACATGG + Intergenic
1151480812 17:74369221-74369243 AGGAGAAGAGGCAGGATGGCAGG - Intronic
1151599720 17:75098810-75098832 TGGAGAGGATGCAGGGCAGAAGG + Intronic
1152099224 17:78291466-78291488 AGGAGAAACTGCAGGGCAGCCGG - Intergenic
1152310293 17:79545743-79545765 TGGTGAAGGCTCAGGACAGCTGG - Intergenic
1152648163 17:81479814-81479836 TGGAGAAGCTGAAGAAAAGCAGG - Intergenic
1152657675 17:81527540-81527562 GGGAGAGGATGAAGGCCAGCAGG - Intergenic
1152885820 17:82848812-82848834 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1152885898 17:82849240-82849262 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1152989173 18:347193-347215 TGGAGAAGTTACAGGCGAGCGGG - Exonic
1153396756 18:4631011-4631033 TGAAGAAAAAGCAGGAAAGCTGG + Intergenic
1154409751 18:14132048-14132070 TGGGGAAGATGCAGGGCTGCGGG + Intronic
1155432811 18:25779118-25779140 TGAAGAAGAAGCAAGAAAGCAGG - Intergenic
1155534936 18:26807358-26807380 TGGAGAAGTTGCAGGAAATTGGG + Intergenic
1156595850 18:38546763-38546785 TGCATAGGATTCAGGACAGCTGG + Intergenic
1156962558 18:43050628-43050650 TGGGGCAGATGGAGGACAGAAGG - Intronic
1157304659 18:46508168-46508190 CTGAGGCGATGCAGGACAGCTGG + Intronic
1157502537 18:48201587-48201609 AGGAGGAGAGGCAGGACACCTGG - Intronic
1157885982 18:51367004-51367026 TGGAGAAAATAGAGGACATCAGG + Intergenic
1158884687 18:61815990-61816012 TGGAGGAGGAGCAGGACAGGCGG - Exonic
1158968152 18:62641834-62641856 TGGAGATGATGCAGATCAACTGG + Intergenic
1160464424 18:79064433-79064455 TGGAGTAGATGCAGGCCAGCTGG - Intergenic
1160666126 19:329590-329612 TTCAGAAGATGCTGGACAGCCGG + Intronic
1161224446 19:3136551-3136573 AGCAGAAGAAGCAGGACCGCGGG + Exonic
1161576576 19:5057897-5057919 TGGAGATGATGCAGGGATGCGGG + Intronic
1161641223 19:5424523-5424545 TGGAGGAGGTACAAGACAGCGGG + Intergenic
1161687027 19:5707962-5707984 TGGAGAACAAGCAGCAGAGCTGG - Intronic
1163574522 19:18102900-18102922 TGGAGAAGACATAGCACAGCAGG - Intronic
1163944596 19:20523520-20523542 GGGAGAAGATGCAGGAATGGAGG + Intergenic
1165301882 19:34975349-34975371 GGAAGAAGATGCAGGAAAGTTGG - Intergenic
1165459884 19:35938041-35938063 TGGAGAAGGAGCAAGAGAGCTGG - Intronic
1165794001 19:38508016-38508038 AGGAGTAGTTGCAGGAGAGCAGG - Intronic
1166700244 19:44878119-44878141 TGGGGGAGATGCAGGATAGGCGG - Intronic
1167295325 19:48646142-48646164 GGGAGAAGAGGCAGGAGAGGAGG - Exonic
1168471537 19:56644125-56644147 AGGAGAAAATGCAGGCAAGCGGG - Intronic
926335671 2:11860856-11860878 TGGGGAAGCTGTAGTACAGCAGG - Intergenic
926629430 2:15123289-15123311 TGGAGAAGATGCTAGAAAGCAGG - Intergenic
927191721 2:20521757-20521779 TGGTGGAGATGCAGGGCAGGGGG - Intergenic
928010411 2:27602307-27602329 AGGAGAAGATGGAGAACACCAGG + Intronic
928732681 2:34250654-34250676 GGGAGAAGATGCAGGAAGGCAGG + Intergenic
929522141 2:42663329-42663351 TGGTGAATGTGCAGGACAGCAGG + Intronic
929594189 2:43165816-43165838 TGGAGAAAACCAAGGACAGCTGG + Intergenic
929944596 2:46360962-46360984 TGATGATGAGGCAGGACAGCAGG - Exonic
930330149 2:49972899-49972921 TGGAGCAGATGGAGGACAGAAGG - Intronic
931119662 2:59202006-59202028 TGAAAAAGATGCAGGAAAGAGGG + Intergenic
932056494 2:68448627-68448649 ACGAGAAGATCCAGGTCAGCAGG - Intergenic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932665741 2:73697339-73697361 TTGAGAGGATGCAGCACACCAGG - Intergenic
933355077 2:81199551-81199573 AGGAGAGGAAGCAGGACAGCAGG - Intergenic
933498055 2:83076282-83076304 TGGAGAAGATAAATTACAGCTGG + Intergenic
933865836 2:86516513-86516535 TGGAGAAGATGTAGAAAAACAGG + Intronic
934854227 2:97718918-97718940 TGGAGAAGATGGAGGGGAGAGGG + Intronic
934888412 2:98045166-98045188 TGCCGAAGATCCAGGACAGGGGG - Intergenic
935194643 2:100805436-100805458 TGGAGAGGATGTAGAACAACAGG + Intergenic
936393969 2:112104577-112104599 TGGAGAGGATGTGGAACAGCTGG + Intronic
936633849 2:114233854-114233876 TGGACAAGATTCAGGACCTCTGG + Intergenic
938402625 2:131005646-131005668 TGCAGAAGATGCAGGGGAGCTGG + Intronic
938520841 2:132068874-132068896 GAGAGCAGATGCAGGACAGTGGG - Intergenic
939780984 2:146447203-146447225 TGGTGAAGATGTAGAACAACAGG - Intergenic
940876835 2:158906323-158906345 TCGAGAGGATGCAGGGCAACTGG + Intergenic
941579852 2:167281715-167281737 TGGTGAAGGTGCAGGGCAACAGG - Intergenic
941746532 2:169092696-169092718 AGGAGAAGATGGAAGACACCAGG + Intronic
942309000 2:174636577-174636599 TGGAACAGATAAAGGACAGCAGG - Intronic
942478402 2:176354134-176354156 TGGAGAAGATGCAGAAAAGGTGG - Intergenic
942682127 2:178487828-178487850 TGGCAAAGATGCAGAACAACTGG - Intronic
946169830 2:217888293-217888315 TGGAGCAGATGGAGGAGAGGAGG - Intronic
946351957 2:219160934-219160956 TGGAGGAGAGGCCGGGCAGCCGG + Intronic
947556399 2:231097144-231097166 TGGATAAGATGGAGGATAGTTGG + Intronic
948248138 2:236503714-236503736 TGGAGAGGCATCAGGACAGCTGG - Intronic
948392012 2:237618702-237618724 TGGTGAGGATGCGGGGCAGCTGG - Intergenic
1169716243 20:8621908-8621930 GGAAGAAGATACAGAACAGCTGG + Intronic
1170868295 20:20180518-20180540 TGGAGAGGTTGCAGAAAAGCAGG + Intronic
1172390212 20:34560591-34560613 AGGAGAAGAGGCAGGTGAGCAGG - Exonic
1172441800 20:34971363-34971385 TTGTGAAGATGGGGGACAGCTGG + Intergenic
1173003855 20:39124788-39124810 TGGAGAAGAAGCATGTCAGCTGG - Intergenic
1173653844 20:44685303-44685325 AGGAGAGGAGGCAGGACGGCTGG - Intergenic
1174079459 20:47960755-47960777 TGGTGGAGGTGCAGCACAGCTGG - Intergenic
1174568979 20:51487658-51487680 CTGAGGAAATGCAGGACAGCCGG + Intronic
1175619530 20:60431576-60431598 TGGAGAGGAAGCAGGAGACCGGG - Intergenic
1175735703 20:61385625-61385647 GGGAGAGGAGGCAGGAGAGCAGG - Intronic
1175802457 20:61808722-61808744 TGGACAATATGCAGGAACGCGGG - Intronic
1176863474 21:14027805-14027827 TGGGGAAGATGCAGGGCTGCGGG - Intergenic
1177404653 21:20649509-20649531 TGGAGAGCATGCAGGGCAACGGG + Intergenic
1178337297 21:31754832-31754854 TGGAGCTCCTGCAGGACAGCGGG + Intergenic
1178399799 21:32275781-32275803 TGGAGTAGATACAGGGGAGCAGG - Intronic
1178905309 21:36631555-36631577 TGGAGAAGATGGAAAAAAGCGGG + Intergenic
1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG + Exonic
1180956404 22:19743315-19743337 TGGAGAGGACGCCAGACAGCAGG - Intergenic
1181075737 22:20375548-20375570 TGGAGAAGATGCAGGACAGCCGG - Exonic
1181421563 22:22802913-22802935 TGGAGAATATGAAGGGCAGGAGG - Intronic
1181425446 22:22834688-22834710 TGGAGAAAATGAAGGGCAGGAGG - Intronic
1181429690 22:22871559-22871581 TGGAGAAAATGAAGGGCAGTAGG - Intronic
1181436685 22:22915165-22915187 TGCAGAAGATCCAGGAGAGACGG + Intergenic
1181457241 22:23066768-23066790 TGCAGAAGAGGTAGGACAGGTGG + Intronic
1181636452 22:24176932-24176954 TGGAGACGAGCCAGGCCAGCCGG + Intronic
1181903393 22:26173511-26173533 TCGAGCGGATGCAGGAGAGCAGG + Intronic
1181928374 22:26378673-26378695 TGAAGAAGATGCCAGACAGAAGG + Intronic
1182285588 22:29245148-29245170 AGGAGGAGATTCAGGACAGCAGG - Intronic
1182974337 22:34608771-34608793 TGGAGAAGCTGCAGTTCAGAAGG + Intergenic
1183229184 22:36570244-36570266 TGGACAAGATGGAGGGCGGCGGG + Intronic
1184066007 22:42121290-42121312 TGGAGAGGATGTAGAACAACTGG - Intergenic
1184180437 22:42820082-42820104 TGGAGAAGCTGCAGGTAAGCTGG - Intronic
1184218094 22:43080648-43080670 TGGAGAAGAGGCAGTGCAGAGGG - Intronic
1184595088 22:45509126-45509148 TGCAGAGGATGCATGACAGGTGG + Intronic
1185404966 22:50642525-50642547 TGGGGAAGATGAAGGCCACCAGG - Intergenic
952776759 3:37053875-37053897 TGGAGAAGATGAAGGCCAATAGG - Exonic
955479292 3:59373163-59373185 TGGTGAGGATGCAGGGCAACAGG + Intergenic
955910096 3:63851135-63851157 TTGAGAAGATACAGTACACCAGG - Intronic
955942944 3:64164048-64164070 TGGAGAAGATGGAAGACTGAGGG + Intronic
958962474 3:100523134-100523156 TGCAGAAGATGTAGCAAAGCTGG - Intronic
960615695 3:119594029-119594051 TGCAGGACATACAGGACAGCAGG + Intergenic
960933613 3:122880741-122880763 TGGTGAAGGTTCAGGAAAGCTGG + Exonic
960957576 3:123044853-123044875 TGGAGAAGATGAAGGGGAGGAGG - Intergenic
961039060 3:123664133-123664155 TGGAGAACAAGCTGGGCAGCAGG - Exonic
961362950 3:126379626-126379648 TTGAGAAGAGACAGGAAAGCAGG - Intergenic
961440924 3:126952754-126952776 TGGAGAAGGTCCAGGAGAGGTGG + Intronic
961615282 3:128174536-128174558 TGGAGAAGCTGCAGCACAACAGG + Intronic
962282587 3:134063461-134063483 TGGAGTTGATGCAGGAATGCAGG - Intergenic
962403440 3:135080564-135080586 TGGAGGAGAGGGGGGACAGCAGG + Intronic
963900904 3:150732779-150732801 GGGTATAGATGCAGGACAGCTGG + Intergenic
964245058 3:154642206-154642228 AGGAGAAGCTGCAGGGGAGCAGG - Intergenic
967069753 3:185952483-185952505 GGGAGAAGAGGCGGGACATCTGG + Intergenic
967198302 3:187048797-187048819 TGGAGAACATCCAGCACAGAAGG - Intronic
969224025 4:5782684-5782706 AAGACAAGAGGCAGGACAGCCGG + Intronic
969456141 4:7300757-7300779 TGGAGATGAGGAAGGCCAGCGGG - Intronic
969519799 4:7669467-7669489 TGGAGAGGAAGCAGGCTAGCTGG - Intronic
969937447 4:10696328-10696350 TGGAGCAGATGCAGCAAAGGGGG - Intergenic
970132231 4:12884732-12884754 TGGAGAAGAGGCTGGAAAGCTGG - Intergenic
970614553 4:17755914-17755936 TGGAGAAGAGGGAGAACATCAGG + Intronic
971132037 4:23822250-23822272 TGGAGCAGAAGCAAGAAAGCAGG - Intronic
971990147 4:33881900-33881922 TGAAGATGATGCAGGACAAAAGG - Intergenic
972943239 4:44222585-44222607 GAAAGATGATGCAGGACAGCAGG - Intronic
974834676 4:67233253-67233275 TGGATAAGATGTAGGACTCCAGG + Intergenic
976002141 4:80386402-80386424 TGGAGGAGATGAAGGACACAGGG - Intronic
978232560 4:106418518-106418540 TGGAGAACATGAGGGACAGAAGG - Intergenic
978278711 4:106983967-106983989 TGGTGAGGATGCAGAACAACTGG + Intronic
978405389 4:108373251-108373273 TGGAGCAGATGCAGGACACACGG + Intergenic
978434828 4:108672792-108672814 TTGAGAAGAGGCAGGAAAGGAGG + Intergenic
982204371 4:152986098-152986120 TGGAGAAGGTGCAGAAAAACAGG + Intergenic
982401469 4:154972515-154972537 TGGAGAACTTAGAGGACAGCAGG + Intergenic
984068895 4:175086706-175086728 TGGAGCTGATGCAAGACAGGTGG - Intergenic
984177223 4:176434529-176434551 AAGAGAAGATGAAGGACAACTGG + Intergenic
984489736 4:180417816-180417838 TGGACAAGATGGAGGCCAGGGGG + Intergenic
986031116 5:3893319-3893341 AGGAGAGGAAGCAGGACAGCAGG - Intergenic
986056175 5:4139051-4139073 TTGAGAAGATGCAGGTCAAAGGG - Intergenic
986589661 5:9355395-9355417 TAGAGAAGATGGAGGAAAGGAGG + Intronic
986642666 5:9887923-9887945 TGGGGAGTAGGCAGGACAGCAGG + Intergenic
988470427 5:31532330-31532352 TGGAGAAGACCCGGGAAAGCCGG - Exonic
990724279 5:58736137-58736159 TGCAGGAGCTGCAGGAAAGCAGG - Intronic
993103912 5:83576703-83576725 TGGAGAAGATGTAGAGCAACAGG - Intronic
993370900 5:87090813-87090835 TGGAGGAGATGCTGGAAAGAGGG + Intergenic
994626399 5:102225604-102225626 TGAAGAAGATGCAGTGCAGGAGG - Intergenic
995019284 5:107348626-107348648 TGGAGAAGATAAAGAACAGCTGG + Intergenic
996643957 5:125792814-125792836 TGGAGAACATGCTGGATAGTAGG - Intergenic
996809778 5:127503802-127503824 TGGAGAAGAAGTAGGGAAGCAGG + Intergenic
996836777 5:127802409-127802431 TGGAGATGAGGCAGGAAAGGGGG - Intergenic
997452329 5:133993967-133993989 TGGAGAAGGTGCAGGAGATGAGG - Intronic
997691801 5:135832308-135832330 TGGAGAAGCAGGAGGAAAGCTGG + Intergenic
998036771 5:138924006-138924028 AGGAGAAGGTGCTGGAAAGCAGG - Intronic
998301625 5:141027474-141027496 TGGATAATATCCAGGACAGATGG + Intergenic
998533908 5:142911336-142911358 TGGAGAAACAGCAGGGCAGCTGG - Intronic
999633520 5:153596651-153596673 TGGAGGAGAGGCAGGAGAGATGG + Intronic
1000670135 5:164051301-164051323 GGCAGAAGGTGAAGGACAGCTGG - Intergenic
1000900015 5:166901613-166901635 TGTAGAAGATTCAGAAAAGCTGG + Intergenic
1001055294 5:168444534-168444556 TGGAGAAGAGGCAGGAGGGCAGG + Exonic
1001262810 5:170246608-170246630 GGGAGTAGTTGCAGGGCAGCAGG + Exonic
1001538888 5:172523096-172523118 AGGAGATAATGCAGGAGAGCAGG - Intergenic
1001549772 5:172594543-172594565 TGGGGAGGAGACAGGACAGCAGG - Intergenic
1001686259 5:173597069-173597091 GGGAGAAGAAACAGGAGAGCTGG - Intergenic
1001916989 5:175570006-175570028 TGGAGAATCAGCAGGAGAGCAGG - Intergenic
1001970832 5:175953803-175953825 TGGACAAGGAGCAGGGCAGCGGG - Intronic
1002106400 5:176881364-176881386 TGGAGAAGATCCGGGAGAACCGG - Exonic
1002246606 5:177889961-177889983 TGGACAAGGAGCAGGGCAGCGGG + Intergenic
1002525430 5:179813038-179813060 TGCAGAAGATGAAGGACCCCTGG - Intronic
1002535876 5:179875105-179875127 CGGAGAAGATGCAGGACCTGGGG - Exonic
1003137354 6:3443979-3444001 TTGGAAAGATGCAGGGCAGCAGG - Intronic
1003589479 6:7425222-7425244 TGTAGACTGTGCAGGACAGCAGG + Intergenic
1004115409 6:12761932-12761954 TGGAAGAAATGCAGGGCAGCTGG - Intronic
1004358791 6:14952686-14952708 TGGAGGAGATGCTGGGCATCAGG - Intergenic
1005042863 6:21615131-21615153 GGAACAAGATGCAGGACAGCTGG + Intergenic
1007251044 6:40495273-40495295 GTGAGAAAATGCAGGTCAGCTGG - Intronic
1007834957 6:44667135-44667157 GGGAGAGGATGAAGGAAAGCAGG + Intergenic
1008434303 6:51457020-51457042 TAGAGAAGAAGCAGGATATCAGG + Intergenic
1008892772 6:56513941-56513963 TGGAGAAGATGCTGTAGAGCTGG + Intronic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1012943926 6:105446512-105446534 TGAAGAAGATGAAGGAGACCTGG - Intergenic
1014141555 6:117949403-117949425 TGGATATGATGGAAGACAGCAGG - Intronic
1014852272 6:126356396-126356418 TGAAGGAGATACGGGACAGCGGG + Intergenic
1015109958 6:129581334-129581356 TGGATCAGATGCAGTGCAGCAGG - Intronic
1015689502 6:135905897-135905919 TTGAGGAGAAGCAGGACAGAAGG + Intronic
1015982906 6:138857106-138857128 TGGAGAAGATGAAAGGCAACGGG - Intronic
1016290157 6:142519436-142519458 TGGAGATGATGGTGGACAGGAGG - Intergenic
1016314508 6:142771347-142771369 TGAAGAGGAGGCAGCACAGCAGG + Exonic
1017305726 6:152916337-152916359 AGGAGAAGATGTAGTACAGCAGG - Intergenic
1017953722 6:159160673-159160695 TGGAAAATATGCAAGAAAGCAGG + Intergenic
1018836286 6:167486721-167486743 TGGAGGAGAGGCAGGAGAGGAGG - Intergenic
1018994751 6:168702251-168702273 GGGAGAAGCTGCAGGACACGAGG - Intergenic
1019034216 6:169041224-169041246 TGAAGAAGGGGCAGGAAAGCAGG + Intergenic
1019769076 7:2871948-2871970 TGGAGAAGGTCCAGGTGAGCAGG + Intergenic
1019972960 7:4557054-4557076 AGAAGAAGATGCCAGACAGCGGG - Intergenic
1021483676 7:21145153-21145175 AGGAGAAGGTGGTGGACAGCTGG - Intergenic
1022941638 7:35247071-35247093 GGGAGCTGATGCAGGCCAGCAGG - Intronic
1024062396 7:45708859-45708881 TGGAGAAGACACAGGGCGGCTGG - Intronic
1024365579 7:48516749-48516771 TGGAAAAGATTCTGGACATCAGG - Exonic
1026636074 7:72082899-72082921 ATGAGAAGATGCAAGAAAGCAGG + Intronic
1027499664 7:78933130-78933152 GGTAGAAAATGCAGGAAAGCAGG + Intronic
1029142189 7:98419186-98419208 TGGAAAAGGTGAAGGACACCAGG + Intergenic
1029274708 7:99397235-99397257 TGGTGAGGAGGCAGGACAGATGG + Intronic
1029307149 7:99628776-99628798 TGGGGAAGGCGCAGGACATCTGG + Intronic
1029377444 7:100188050-100188072 TAAAGAAGATGCAGGCCAGCCGG - Intronic
1029702093 7:102253889-102253911 TGAAGAAGAGGGAGGACATCTGG - Exonic
1030088961 7:105840574-105840596 TGGAGAAGATACAACAGAGCTGG - Intronic
1030890124 7:114989488-114989510 TGGAAAAGATCCAGGAGAGAAGG + Intronic
1031014942 7:116563448-116563470 TGGTGAAGATGCAGGCGAGTGGG + Intergenic
1031739969 7:125417937-125417959 GGGAGATCATGCAGGACAGGAGG + Intergenic
1032195564 7:129786392-129786414 TGGAGAAAAGGCAGGGCAGAGGG + Intergenic
1033021387 7:137728524-137728546 GGGAAAAGATGAAGGAAAGCTGG + Intronic
1034383873 7:150721948-150721970 TGGAGAAGAGGCAGAGCACCAGG + Exonic
1034557065 7:151856863-151856885 AGGAGAAGATACAGGACAGCAGG + Intronic
1034740763 7:153471459-153471481 ACGAGCAGATGCAGGAGAGCTGG - Intergenic
1035101399 7:156400473-156400495 TGGAGAAGACCCAGGACAGGAGG - Intergenic
1035101699 7:156402635-156402657 TGGAGAAGACCCAGGACAGGAGG - Intergenic
1035524268 8:300002-300024 TGGAGAAAATGCAGAACAAGTGG - Intergenic
1035666958 8:1386428-1386450 TGGAGAAGATGGAAGCCATCTGG - Intergenic
1036541377 8:9715510-9715532 GGGAGGAGATAGAGGACAGCAGG - Intronic
1036590134 8:10161664-10161686 TGGAGAGAATGCAGGAGACCCGG + Intronic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1037181970 8:16018171-16018193 TGGTGAATAGGCAGGACAACAGG - Intergenic
1037689869 8:21172628-21172650 AGGAGAAGTTGCAGGGCAGGGGG + Intergenic
1037977321 8:23222921-23222943 TGGTGAAGGGGAAGGACAGCTGG - Intronic
1039161976 8:34631807-34631829 TTGAGCAGATGCAGGAGAGCTGG - Intergenic
1039260589 8:35766988-35767010 TGCAGATTTTGCAGGACAGCTGG - Exonic
1040288224 8:46111194-46111216 AGGAGAAGTGGCAAGACAGCAGG - Intergenic
1040291519 8:46127968-46127990 AGGAGAAGTGGCAGGACTGCAGG - Intergenic
1040295704 8:46148013-46148035 GGGAGAAGCAGCATGACAGCAGG - Intergenic
1040295881 8:46148865-46148887 TGGAGAGAATGCAGGAATGCCGG - Intergenic
1040303007 8:46197710-46197732 GGGAGAAGAGGCAAGACGGCAGG + Intergenic
1040315642 8:46259490-46259512 GGGAGAAGTGGCAAGACAGCAGG + Intergenic
1040316127 8:46261841-46261863 AGGAGAAGAGGCAAGACTGCAGG + Intergenic
1040329956 8:46380853-46380875 GGGAGAAGCAGCAAGACAGCAGG + Intergenic
1040330669 8:46384173-46384195 GGGAGAAGAGGCAGGACAGCAGG + Intergenic
1040550921 8:48436988-48437010 TGGAGATGGTGCAGGAAAGAAGG + Intergenic
1041845494 8:62323036-62323058 TGGAGAAAATATGGGACAGCAGG + Intronic
1042743336 8:72075735-72075757 TGCTGCAGCTGCAGGACAGCGGG - Intronic
1042759123 8:72251889-72251911 TGCTGCAGCTGCAGGACAGCGGG - Intergenic
1042790752 8:72603108-72603130 TGGAGAGGATGCAGGAGACAAGG - Intronic
1043190672 8:77218622-77218644 TGGAGAAACTGCAGGTAAGCTGG + Intergenic
1044602809 8:94022610-94022632 TGGCAAAGATGCAGGGCAACTGG + Intergenic
1044937816 8:97309886-97309908 AGGAGATGCTGGAGGACAGCTGG - Intergenic
1045243733 8:100424871-100424893 TGGGGAAAATGCAGAACAACAGG - Intergenic
1045460992 8:102425675-102425697 TGGACAAGAAGCGGGAAAGCAGG + Intergenic
1047602959 8:126445508-126445530 TGGTGAAGATGCAGAGCAACTGG + Intergenic
1047796875 8:128266595-128266617 TGAAGAAGAGGCAAGATAGCTGG - Intergenic
1048478025 8:134760545-134760567 TGGAGAAGTTGCAGGAGTGGCGG + Intergenic
1049658854 8:143810799-143810821 TGCAGAGGATGCTGGGCAGCAGG - Exonic
1050616833 9:7410078-7410100 TGGAGAACATGGAGGAAATCAGG - Intergenic
1050901819 9:10959890-10959912 GGGAGAGAAGGCAGGACAGCAGG - Intergenic
1053606671 9:39666945-39666967 TGGAGAAGATGCCAAACTGCAGG + Intergenic
1054246864 9:62675459-62675481 TGGAGAAGATGCCAAACTGCAGG - Intergenic
1054560985 9:66709993-66710015 TGGAGAAGATGCCAAACTGCAGG - Intergenic
1055584626 9:77745184-77745206 TGAACAAGAGGCAGGACAGATGG + Intronic
1055856949 9:80700035-80700057 TGGTGGAGATACAGAACAGCTGG - Intergenic
1056066797 9:82944133-82944155 TGATGAAGATGTAGGACAACTGG - Intergenic
1056309155 9:85321958-85321980 TGGAGTAGATGCAGGGCACTCGG - Intergenic
1056718537 9:89053939-89053961 TGGTGCTGATGCTGGACAGCAGG - Intronic
1056819307 9:89826121-89826143 GGGAGAAGCTGCAGGGTAGCTGG + Intergenic
1056955868 9:91080629-91080651 TGGAGAGGATGCAGAGAAGCTGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057958767 9:99434593-99434615 TGGAGAAGAAGCAAGGCAGAGGG - Intergenic
1058923419 9:109639939-109639961 TGTAGCAGGTGCAGGACACCTGG + Intergenic
1060406261 9:123374537-123374559 TGGAGTGGGTGCAGGACACCTGG - Intronic
1060695154 9:125703055-125703077 TGGAAAAGATGCTGGAAATCTGG - Intronic
1061056358 9:128224864-128224886 TGGGGAGGATGAAGGACAGCGGG - Intronic
1061599189 9:131655472-131655494 GAGAGAAGAGGCAGGACAGAGGG - Intronic
1061938695 9:133872568-133872590 TGGAGCAGAGGCAGGAAGGCTGG + Intronic
1062665348 9:137668084-137668106 TGGAGAAGAGGCAGGACCAGTGG + Intronic
1185716801 X:2349270-2349292 TGAAGAAAATGCGGTACAGCTGG + Intronic
1187995184 X:24918772-24918794 GGGGGAAGATGAAGGAGAGCTGG + Intronic
1188266276 X:28079570-28079592 TGTACAAGATGCAGGAAAGGAGG + Intergenic
1188986262 X:36771102-36771124 GGGACAAGATACAGGACAGCAGG - Intergenic
1189357064 X:40318077-40318099 TAGAGAAAAGGCAGAACAGCAGG - Intergenic
1190699846 X:52979520-52979542 GGGAGAAGGAGAAGGACAGCTGG - Intronic
1191033984 X:56005816-56005838 TGGAGAGGATGCAGGTAGGCTGG + Intergenic
1192551223 X:72055276-72055298 TGGAGAAGATGCAGCAAGCCCGG - Intergenic
1194369272 X:93050771-93050793 TGGAGAGGATGTAGAAAAGCAGG - Intergenic
1195418610 X:104647676-104647698 TGGTGAAGATGCAAGGAAGCTGG + Intronic
1196169615 X:112573334-112573356 TGGGGAGGATGTAGAACAGCTGG + Intergenic
1197697407 X:129565368-129565390 TGGAGAACCTGCAGGACTTCAGG + Intronic
1198133822 X:133726987-133727009 TTGAGAAGAAGCAGGAGACCTGG - Intronic
1198596711 X:138243820-138243842 TGGAGCAAAGGCAGGACAGAAGG + Intergenic
1200227510 X:154427082-154427104 TAGAGGACATGCAGGACAGCAGG - Intergenic