ID: 1180758904

View in Genome Browser
Species Human (GRCh38)
Location 22:18183821-18183843
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180758897_1180758904 13 Left 1180758897 22:18183785-18183807 CCAGGATAAGTCATTAGAGAGAG No data
Right 1180758904 22:18183821-18183843 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180758904 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr