ID: 1180762899

View in Genome Browser
Species Human (GRCh38)
Location 22:18222844-18222866
Sequence GACACTGGGGGGTTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180762899_1180762908 -2 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762908 22:18222865-18222887 TCTTTGGCAGCAGGGCCGAGAGG No data
1180762899_1180762911 19 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762899_1180762912 24 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762912 22:18222891-18222913 AAGCCTCGGCCTTCCTGGTGAGG No data
1180762899_1180762909 10 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762909 22:18222877-18222899 GGGCCGAGAGGACGAAGCCTCGG No data
1180762899_1180762905 -10 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762905 22:18222857-18222879 CCCCAGTGTCTTTGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180762899 Original CRISPR GACACTGGGGGGTTTCTTCC TGG (reversed) Intergenic
No off target data available for this crispr