ID: 1180762901

View in Genome Browser
Species Human (GRCh38)
Location 22:18222855-18222877
Sequence CTGCTGCCAAAGACACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180762901_1180762911 8 Left 1180762901 22:18222855-18222877 CCCCCCAGTGTCTTTGGCAGCAG No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762901_1180762912 13 Left 1180762901 22:18222855-18222877 CCCCCCAGTGTCTTTGGCAGCAG No data
Right 1180762912 22:18222891-18222913 AAGCCTCGGCCTTCCTGGTGAGG No data
1180762901_1180762909 -1 Left 1180762901 22:18222855-18222877 CCCCCCAGTGTCTTTGGCAGCAG No data
Right 1180762909 22:18222877-18222899 GGGCCGAGAGGACGAAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180762901 Original CRISPR CTGCTGCCAAAGACACTGGG GGG (reversed) Intergenic
No off target data available for this crispr