ID: 1180762905

View in Genome Browser
Species Human (GRCh38)
Location 22:18222857-18222879
Sequence CCCCAGTGTCTTTGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180762894_1180762905 21 Left 1180762894 22:18222813-18222835 CCTAAGTCCAAGAGAGACAGCTG No data
Right 1180762905 22:18222857-18222879 CCCCAGTGTCTTTGGCAGCAGGG No data
1180762897_1180762905 14 Left 1180762897 22:18222820-18222842 CCAAGAGAGACAGCTGCGAGGGC No data
Right 1180762905 22:18222857-18222879 CCCCAGTGTCTTTGGCAGCAGGG No data
1180762899_1180762905 -10 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762905 22:18222857-18222879 CCCCAGTGTCTTTGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180762905 Original CRISPR CCCCAGTGTCTTTGGCAGCA GGG Intergenic
No off target data available for this crispr