ID: 1180762907

View in Genome Browser
Species Human (GRCh38)
Location 22:18222859-18222881
Sequence GGCCCTGCTGCCAAAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180762907_1180762909 -5 Left 1180762907 22:18222859-18222881 CCAGTGTCTTTGGCAGCAGGGCC No data
Right 1180762909 22:18222877-18222899 GGGCCGAGAGGACGAAGCCTCGG No data
1180762907_1180762911 4 Left 1180762907 22:18222859-18222881 CCAGTGTCTTTGGCAGCAGGGCC No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762907_1180762912 9 Left 1180762907 22:18222859-18222881 CCAGTGTCTTTGGCAGCAGGGCC No data
Right 1180762912 22:18222891-18222913 AAGCCTCGGCCTTCCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180762907 Original CRISPR GGCCCTGCTGCCAAAGACAC TGG (reversed) Intergenic
No off target data available for this crispr