ID: 1180762911

View in Genome Browser
Species Human (GRCh38)
Location 22:18222886-18222908
Sequence GGACGAAGCCTCGGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180762904_1180762911 6 Left 1180762904 22:18222857-18222879 CCCCAGTGTCTTTGGCAGCAGGG No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762899_1180762911 19 Left 1180762899 22:18222844-18222866 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762907_1180762911 4 Left 1180762907 22:18222859-18222881 CCAGTGTCTTTGGCAGCAGGGCC No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762906_1180762911 5 Left 1180762906 22:18222858-18222880 CCCAGTGTCTTTGGCAGCAGGGC No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762902_1180762911 7 Left 1180762902 22:18222856-18222878 CCCCCAGTGTCTTTGGCAGCAGG No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data
1180762901_1180762911 8 Left 1180762901 22:18222855-18222877 CCCCCCAGTGTCTTTGGCAGCAG No data
Right 1180762911 22:18222886-18222908 GGACGAAGCCTCGGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180762911 Original CRISPR GGACGAAGCCTCGGCCTTCC TGG Intergenic
No off target data available for this crispr