ID: 1180763856

View in Genome Browser
Species Human (GRCh38)
Location 22:18231052-18231074
Sequence TATTTCAGCAGAAACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180763856_1180763857 -1 Left 1180763856 22:18231052-18231074 CCTGCAGGGTTTCTGCTGAAATA No data
Right 1180763857 22:18231074-18231096 ATCCACTGATAATCTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180763856 Original CRISPR TATTTCAGCAGAAACCCTGC AGG (reversed) Intergenic
No off target data available for this crispr