ID: 1180766140

View in Genome Browser
Species Human (GRCh38)
Location 22:18346756-18346778
Sequence CAGTTCCAACACCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180766133_1180766140 5 Left 1180766133 22:18346728-18346750 CCTCGGGGCCTGCTCCCTCCTCT No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766123_1180766140 29 Left 1180766123 22:18346704-18346726 CCATCGGCAGCCCCTCCAGGCCT No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766136_1180766140 -10 Left 1180766136 22:18346743-18346765 CCTCCTCTGTGCACAGTTCCAAC No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766127_1180766140 19 Left 1180766127 22:18346714-18346736 CCCCTCCAGGCCTCCCTCGGGGC No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766131_1180766140 9 Left 1180766131 22:18346724-18346746 CCTCCCTCGGGGCCTGCTCCCTC No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766132_1180766140 6 Left 1180766132 22:18346727-18346749 CCCTCGGGGCCTGCTCCCTCCTC No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766130_1180766140 14 Left 1180766130 22:18346719-18346741 CCAGGCCTCCCTCGGGGCCTGCT No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766135_1180766140 -9 Left 1180766135 22:18346742-18346764 CCCTCCTCTGTGCACAGTTCCAA No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766128_1180766140 18 Left 1180766128 22:18346715-18346737 CCCTCCAGGCCTCCCTCGGGGCC No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766129_1180766140 17 Left 1180766129 22:18346716-18346738 CCTCCAGGCCTCCCTCGGGGCCT No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data
1180766134_1180766140 -3 Left 1180766134 22:18346736-18346758 CCTGCTCCCTCCTCTGTGCACAG No data
Right 1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180766140 Original CRISPR CAGTTCCAACACCTGGAGCA GGG Intergenic
No off target data available for this crispr