ID: 1180768820

View in Genome Browser
Species Human (GRCh38)
Location 22:18364572-18364594
Sequence CTCTGCAAGCAGCTGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180768812_1180768820 17 Left 1180768812 22:18364532-18364554 CCTTCGCCAGGGAGCCACGGGGC No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data
1180768813_1180768820 11 Left 1180768813 22:18364538-18364560 CCAGGGAGCCACGGGGCTTTCCT No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data
1180768806_1180768820 28 Left 1180768806 22:18364521-18364543 CCCTCACTGCTCCTTCGCCAGGG No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data
1180768808_1180768820 27 Left 1180768808 22:18364522-18364544 CCTCACTGCTCCTTCGCCAGGGA No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data
1180768817_1180768820 -9 Left 1180768817 22:18364558-18364580 CCTCCTCAGGAGGACTCTGCAAG No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data
1180768815_1180768820 3 Left 1180768815 22:18364546-18364568 CCACGGGGCTTTCCTCCTCAGGA No data
Right 1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180768820 Original CRISPR CTCTGCAAGCAGCTGGATGA AGG Intergenic
No off target data available for this crispr