ID: 1180769191

View in Genome Browser
Species Human (GRCh38)
Location 22:18367612-18367634
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180769184_1180769191 13 Left 1180769184 22:18367576-18367598 CCAGGATAAGTCATTAGAGAGAG No data
Right 1180769191 22:18367612-18367634 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180769191 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr