ID: 1180771790

View in Genome Browser
Species Human (GRCh38)
Location 22:18393490-18393512
Sequence TATTTCAGCAGAAACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180771789_1180771790 -1 Left 1180771789 22:18393468-18393490 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180771790 22:18393490-18393512 TATTTCAGCAGAAACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180771790 Original CRISPR TATTTCAGCAGAAACCCTGC AGG Intergenic
No off target data available for this crispr