ID: 1180772746

View in Genome Browser
Species Human (GRCh38)
Location 22:18401703-18401725
Sequence GACACTGGGGGGTTTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180772740_1180772746 -10 Left 1180772740 22:18401690-18401712 CCCTGCTGCCAAAGACACTGGGG No data
Right 1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG No data
1180772737_1180772746 -2 Left 1180772737 22:18401682-18401704 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG No data
1180772733_1180772746 24 Left 1180772733 22:18401656-18401678 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG No data
1180772736_1180772746 10 Left 1180772736 22:18401670-18401692 CCGGGGCTTCGTCCTCTCGGCCC No data
Right 1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG No data
1180772734_1180772746 19 Left 1180772734 22:18401661-18401683 CCAGGAAGGCCGGGGCTTCGTCC No data
Right 1180772746 22:18401703-18401725 GACACTGGGGGGTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180772746 Original CRISPR GACACTGGGGGGTTTCTTCC TGG Intergenic
No off target data available for this crispr