ID: 1180777121

View in Genome Browser
Species Human (GRCh38)
Location 22:18494783-18494805
Sequence TCCCACCCTAGCTGAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180777121_1180777128 13 Left 1180777121 22:18494783-18494805 CCATGGCTTCAGCTAGGGTGGGA No data
Right 1180777128 22:18494819-18494841 CTCTCTCTAATGACTTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180777121 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG (reversed) Intergenic
No off target data available for this crispr