ID: 1180781234

View in Genome Browser
Species Human (GRCh38)
Location 22:18521002-18521024
Sequence CCAGGTAAACCCTCGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180781221_1180781234 25 Left 1180781221 22:18520954-18520976 CCAGCGCCGTGAGGTCCTGTTGA No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781226_1180781234 -3 Left 1180781226 22:18520982-18521004 CCACCTCACTGTGATCATCCCCA No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781220_1180781234 30 Left 1180781220 22:18520949-18520971 CCAGGCCAGCGCCGTGAGGTCCT No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781225_1180781234 -2 Left 1180781225 22:18520981-18521003 CCCACCTCACTGTGATCATCCCC No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781223_1180781234 10 Left 1180781223 22:18520969-18520991 CCTGTTGAGCCACCCACCTCACT No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781224_1180781234 1 Left 1180781224 22:18520978-18521000 CCACCCACCTCACTGTGATCATC No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781228_1180781234 -6 Left 1180781228 22:18520985-18521007 CCTCACTGTGATCATCCCCAGGT No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data
1180781222_1180781234 19 Left 1180781222 22:18520960-18520982 CCGTGAGGTCCTGTTGAGCCACC No data
Right 1180781234 22:18521002-18521024 CCAGGTAAACCCTCGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180781234 Original CRISPR CCAGGTAAACCCTCGGACGT GGG Intergenic
No off target data available for this crispr