ID: 1180782655

View in Genome Browser
Species Human (GRCh38)
Location 22:18529596-18529618
Sequence TCTGCAGCGCGTCCTGGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180782655_1180782662 4 Left 1180782655 22:18529596-18529618 CCACACCCAGGACGCGCTGCAGA 0: 3
1: 0
2: 0
3: 13
4: 155
Right 1180782662 22:18529623-18529645 GGAGGCCTGGGCCATATTCCAGG 0: 3
1: 0
2: 0
3: 22
4: 245
1180782655_1180782667 30 Left 1180782655 22:18529596-18529618 CCACACCCAGGACGCGCTGCAGA 0: 3
1: 0
2: 0
3: 13
4: 155
Right 1180782667 22:18529649-18529671 AGACCGTAGTCCTGCAGGTGCGG 0: 3
1: 0
2: 0
3: 5
4: 74
1180782655_1180782666 25 Left 1180782655 22:18529596-18529618 CCACACCCAGGACGCGCTGCAGA 0: 3
1: 0
2: 0
3: 13
4: 155
Right 1180782666 22:18529644-18529666 GGAGCAGACCGTAGTCCTGCAGG 0: 3
1: 0
2: 1
3: 6
4: 77
1180782655_1180782661 -8 Left 1180782655 22:18529596-18529618 CCACACCCAGGACGCGCTGCAGA 0: 3
1: 0
2: 0
3: 13
4: 155
Right 1180782661 22:18529611-18529633 GCTGCAGACAGCGGAGGCCTGGG 0: 3
1: 0
2: 1
3: 34
4: 260
1180782655_1180782660 -9 Left 1180782655 22:18529596-18529618 CCACACCCAGGACGCGCTGCAGA 0: 3
1: 0
2: 0
3: 13
4: 155
Right 1180782660 22:18529610-18529632 CGCTGCAGACAGCGGAGGCCTGG 0: 3
1: 0
2: 2
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180782655 Original CRISPR TCTGCAGCGCGTCCTGGGTG TGG (reversed) Exonic
900367472 1:2317086-2317108 TCTGGAGGGTGTCCTGGCTGAGG + Intergenic
901233859 1:7656985-7657007 CCTGCAGCGCGGCCTGTGTGAGG - Intronic
903550793 1:24156422-24156444 TCTGCAGCTACGCCTGGGTGTGG - Exonic
903587216 1:24425187-24425209 TCTCCAGCTTGTGCTGGGTGGGG + Intronic
903875367 1:26470161-26470183 TCTGCAGCAAGTCCTGGCAGAGG - Exonic
906152103 1:43593441-43593463 GCTGCTGGGCGTCCTGTGTGTGG + Intronic
906157014 1:43619793-43619815 TCTGCAGCCCATCCGTGGTGTGG + Exonic
907373453 1:54017685-54017707 TGGGCAGCGACTCCTGGGTGAGG + Intronic
916578581 1:166088400-166088422 TCTGCAGACCCTGCTGGGTGGGG + Intronic
917793940 1:178519113-178519135 TTTGCAAGGCGGCCTGGGTGGGG + Intronic
922460578 1:225811786-225811808 TCCTCAGCGCCTCCTAGGTGTGG - Intronic
924384789 1:243490723-243490745 TCTTCAGAGGGTCCTGGGAGAGG + Intronic
924599438 1:245475427-245475449 TCTGAGGCGGGTCCTGGTTGGGG + Intronic
1063368700 10:5507370-5507392 GCTGCAGGGTGCCCTGGGTGGGG + Intergenic
1067297079 10:44980730-44980752 TCTGCCTGGCGTCCAGGGTGGGG + Intronic
1069920599 10:71813234-71813256 TCAGCAGCGAGCCCTGGGGGAGG - Exonic
1070568251 10:77620179-77620201 TCTGCCGCTGGTTCTGGGTGAGG - Intronic
1072021760 10:91410024-91410046 TCTCCTGCGCGGCCCGGGTGCGG + Intergenic
1073043996 10:100625527-100625549 TCTGCAGGGGGGCGTGGGTGGGG + Intergenic
1074080677 10:110165946-110165968 GCTGCAGGGAGTCCTGGGTGGGG - Intergenic
1074104131 10:110376205-110376227 TCAGGAGCGCGTGCTGGATGGGG - Intergenic
1074449156 10:113545167-113545189 TCTGCACCAGGTCCTGAGTGAGG + Intergenic
1076618935 10:131774807-131774829 ACTGCAGCGGGTTCTCGGTGGGG - Intergenic
1077007380 11:364632-364654 ACGGCAGCGCCACCTGGGTGTGG + Intergenic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1079168979 11:18074042-18074064 TCTGCAGCCGGTGCTGGGTGTGG - Intronic
1081811312 11:45915668-45915690 TGTGGAGAGGGTCCTGGGTGGGG - Intronic
1083443246 11:62690578-62690600 CCTGCAGCGTGACCTGGGTGGGG - Intronic
1083823659 11:65186411-65186433 TCTGGAGCGGAGCCTGGGTGGGG - Intronic
1084801083 11:71544573-71544595 CCTGCAGAGCGTCCTTTGTGGGG + Intronic
1085403392 11:76247708-76247730 TCTGCAGCCCCTCCAGGCTGAGG - Intergenic
1089732394 11:120527352-120527374 TCTGCAGGGTCTGCTGGGTGGGG + Intronic
1091572385 12:1699325-1699347 ACTGCAGTGCATGCTGGGTGCGG + Intronic
1093134812 12:15437677-15437699 CCTGCAGATCTTCCTGGGTGTGG - Intronic
1097620398 12:61932443-61932465 TCTGCAGAGAGTTATGGGTGTGG - Intronic
1101504124 12:105330833-105330855 TCGGCCGCGGGTCCTGGGGGCGG - Exonic
1101538605 12:105643475-105643497 TCTGCATCTTGTCCTGGGCGTGG - Intergenic
1103871318 12:124094420-124094442 TGTGCAGGGCATTCTGGGTGTGG + Intronic
1105420316 13:20246569-20246591 TCTGCAGCGGGGCTGGGGTGAGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105951333 13:25231764-25231786 TCTGCAGCACCTCCTGGCAGTGG - Intergenic
1106250901 13:27980720-27980742 TCTGCTGCGCGGCCTGCGCGGGG - Intronic
1107429298 13:40325625-40325647 TCTGCAGAGGGTCCTGCTTGAGG - Intergenic
1107963618 13:45579872-45579894 TCTTCAGAGTGCCCTGGGTGGGG - Intronic
1108387337 13:49912017-49912039 TCTTAAGCTCCTCCTGGGTGTGG + Intergenic
1108615488 13:52128612-52128634 TCTGCAGCCTCTCCTGGCTGCGG - Intronic
1113819959 13:113206389-113206411 GCAGCAGGGCGTCCTGGCTGGGG + Intronic
1113892450 13:113743562-113743584 TCTGCAGTGAGGCCTGGCTGGGG - Intergenic
1113905190 13:113816115-113816137 TTTGCAGCGTGTTCTGGATGGGG + Exonic
1113905202 13:113816191-113816213 TTTGCAGCGTGTTCTGGATGGGG + Exonic
1114525586 14:23365523-23365545 TCTGCAGCGCGGCCGGCGGGTGG - Exonic
1119222958 14:72924289-72924311 TGTGCACCAAGTCCTGGGTGAGG + Intergenic
1121242360 14:92439990-92440012 TTTGCAGCACCTCCTGTGTGTGG + Intronic
1121336190 14:93078833-93078855 TCTGCTGTGTGTCCTGGGTCAGG - Intronic
1123129008 14:105970765-105970787 TCTGCAGAGAGTCCCTGGTGGGG + Intergenic
1123156178 14:106228744-106228766 TCTGGAGAGCTTTCTGGGTGAGG - Intergenic
1123409524 15:20046930-20046952 TCTGCAGAGAGTCCCTGGTGGGG + Intergenic
1123518854 15:21053638-21053660 TCTGCAGAGAGTCCCTGGTGGGG + Intergenic
1125503531 15:40253561-40253583 TCTGATGCCTGTCCTGGGTGAGG + Intronic
1125512708 15:40301529-40301551 TCTGCAGCGTGTCGAGGGAGAGG - Intronic
1128084528 15:64876726-64876748 TCTACACCCCGTCCTGGTTGTGG - Intronic
1128231779 15:66040273-66040295 TCAGGAGGGCTTCCTGGGTGAGG + Intronic
1129154271 15:73708117-73708139 TCTTCAGCCCTTCCTGGTTGAGG + Intronic
1129169170 15:73797459-73797481 TCTGCAGCCTGTCCTGAGGGAGG + Intergenic
1131177792 15:90220809-90220831 TCGGCACCGTGTCCTGGCTGAGG + Intronic
1132664233 16:1074293-1074315 TCTGCAGCCTCTCCAGGGTGCGG + Intergenic
1136871275 16:33810106-33810128 TCTGCAGAGAGTCCCTGGTGGGG - Intergenic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1141116501 16:81314379-81314401 TTTGCAGGGCCTCCTTGGTGTGG - Intergenic
1141659747 16:85435522-85435544 TCTGGGGCGGGTCCTGGGGGAGG + Intergenic
1141730923 16:85822342-85822364 GCTGCCCCGCATCCTGGGTGAGG + Intergenic
1141985914 16:87579843-87579865 TCAGCAGCTCTTCCTGGGGGAGG + Intergenic
1203100897 16_KI270728v1_random:1305952-1305974 TCTGCAGAGAGTCCCTGGTGGGG + Intergenic
1142492777 17:289462-289484 TCTGCTGGGCGGCCTTGGTGTGG - Intronic
1147954412 17:44124096-44124118 TCTGCAGCGGGGCCTGGCTGCGG + Intergenic
1150942479 17:69707652-69707674 TCTGCACCGCTTCCTGCCTGTGG - Intergenic
1154274688 18:12948490-12948512 CCGGCAGCGCGGCCTGGGAGAGG - Intronic
1158628774 18:59093935-59093957 TCAGCAGTGGGTCCTGGGCGTGG - Intergenic
1160767176 19:813814-813836 CCCGCAGCGCGTCCTTGGCGGGG + Exonic
1160847579 19:1173354-1173376 TCTGCAGAGCGTGTTGGGGGTGG - Intronic
1160875090 19:1293169-1293191 CCTGCAGGGTGACCTGGGTGTGG + Intronic
1161605304 19:5211633-5211655 TCTGCAACCCATCCGGGGTGTGG - Exonic
1162025085 19:7889087-7889109 TTTGTAGCCCGTCCTGGGTCAGG - Intronic
1162470854 19:10871438-10871460 TCTGCCGGCCGTCCTGGGCGCGG - Intergenic
1167146058 19:47681240-47681262 TCTGCAGGGAGTCCTGAGTGAGG - Exonic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
934843398 2:97645888-97645910 TCTGCACCGCGTAGTGGCTGAGG - Intergenic
945235144 2:207626042-207626064 TCTGCAGCGCCGCCTGGGGCCGG - Intergenic
946168540 2:217879873-217879895 GCTGAAGCCAGTCCTGGGTGGGG - Intronic
946250097 2:218406438-218406460 TCTGCCGGGCGGCCTGGGTGGGG + Intergenic
946307098 2:218862186-218862208 GCTGCAGGGCGTGCCGGGTGAGG + Intronic
947531306 2:230910302-230910324 GCTGCACCCAGTCCTGGGTGTGG + Exonic
948588443 2:239035485-239035507 TCCCCAGCGGGGCCTGGGTGTGG + Intergenic
1170780653 20:19422653-19422675 TCTGCAGTGAGTCCTGGCAGGGG + Intronic
1172776684 20:37411592-37411614 TGTGCAGCACGGCCTGTGTGTGG + Intergenic
1173175661 20:40762991-40763013 TCTGCAGAGCTTCCTGGGAGGGG + Intergenic
1175315880 20:58046338-58046360 TCTGCAGCACGTGCTGGGTCAGG - Intergenic
1175708601 20:61201715-61201737 TCCGCAGAGGGTCCTGAGTGAGG - Intergenic
1175878985 20:62245724-62245746 TCTGCAGCCCGTCACGAGTGAGG - Intronic
1176064652 20:63188263-63188285 TCTGCAGCAGGTGCTGGGTGTGG + Intergenic
1179537219 21:42060425-42060447 TCTGCATGGGTTCCTGGGTGAGG + Intergenic
1180782655 22:18529596-18529618 TCTGCAGCGCGTCCTGGGTGTGG - Exonic
1181126215 22:20703623-20703645 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1181239545 22:21468934-21468956 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1182737571 22:32541867-32541889 TCTGCAGCTCGTGCGGTGTGTGG - Intronic
1183454781 22:37916677-37916699 GCTGCAGCTCCTCCAGGGTGGGG - Intronic
1184214808 22:43059611-43059633 TCTGGAGTGCCCCCTGGGTGTGG + Intronic
1184834786 22:47014766-47014788 GCTCCAGCGCGGCCTGTGTGTGG + Intronic
950451968 3:13070537-13070559 CCTGCCGCGGGTTCTGGGTGGGG + Intronic
951217605 3:20040131-20040153 TCTGCTCCGCGCCCTGGCTGCGG - Exonic
952166538 3:30756004-30756026 TCTCCTGCGAGGCCTGGGTGAGG - Intronic
953242070 3:41158583-41158605 TCTGGAGTGCTTGCTGGGTGAGG + Intergenic
954810496 3:53244294-53244316 TCGGCAGAGCATCCTGGGTTGGG + Intronic
960131868 3:114065389-114065411 TATGCAGCGTGTGATGGGTGAGG - Exonic
961464491 3:127073025-127073047 TCCCCAGCACGTACTGGGTGTGG + Intergenic
964281031 3:155065471-155065493 TCTGTAGCTCGTGCTGGGGGAGG - Intronic
968509968 4:991241-991263 GCTGCAGGCCGTCCTGGGAGGGG + Exonic
968636684 4:1684493-1684515 TCCGCAGCGCGCCCTGTGCGAGG + Intergenic
968945717 4:3662617-3662639 CCTGCACTGCGTCCCGGGTGAGG + Intergenic
975893041 4:79051949-79051971 TCTGCAGAGCTTCCTGGGGCTGG + Intergenic
978499853 4:109397631-109397653 TCTTCAGGGGGCCCTGGGTGGGG + Intergenic
986221157 5:5770320-5770342 TCTGGAGGGCAGCCTGGGTGTGG + Intergenic
993902290 5:93592866-93592888 TCTGCAGCAAATCCTTGGTGAGG - Intronic
994314817 5:98320596-98320618 TCTGCAACGGCTCCAGGGTGAGG + Intergenic
1002138939 5:177126867-177126889 GCTGCACCTCCTCCTGGGTGAGG - Intergenic
1006451470 6:34108068-34108090 TCTGCAGCACAGGCTGGGTGAGG + Intronic
1013059136 6:106614963-106614985 TTTCCAGGGAGTCCTGGGTGGGG - Intronic
1016047878 6:139498966-139498988 TCTGCAACGCCTGCTGTGTGAGG + Intergenic
1019474206 7:1236270-1236292 TCCGCAGGGCGACCTGGGCGCGG - Exonic
1019703827 7:2488093-2488115 TCTGCAGGGCCTCCTGGCTGGGG - Intergenic
1020009467 7:4800298-4800320 GCTGCAGAGTCTCCTGGGTGGGG + Exonic
1022727270 7:32992390-32992412 TCTGCAGCTCCTGCTGGGGGTGG - Intronic
1023155867 7:37251464-37251486 TCTCCAGCTGGTACTGGGTGGGG - Intronic
1025046313 7:55695259-55695281 TCTGCAGCTCCTGCTGGGGGTGG + Intergenic
1026193128 7:68147764-68147786 TCTGCAGTGCTTCATGAGTGCGG - Intergenic
1026524046 7:71139328-71139350 TCTGCTGTGCGTCCTGCGTGTGG - Intronic
1028828260 7:95299348-95299370 TGAGCAGCGCATCCTGGATGTGG + Intronic
1031530112 7:122865900-122865922 CCTGCAGAGGGTGCTGGGTGGGG - Intronic
1032074472 7:128830074-128830096 TCTTCAGCCCGTGCGGGGTGTGG + Intergenic
1034589841 7:152129466-152129488 TCTACAGGCCGTCTTGGGTGAGG - Intergenic
1035222597 7:157414970-157414992 TCTGGGGCGAGTCCTGAGTGTGG + Intronic
1035485291 7:159218743-159218765 TCTGCATCGCTTCCTGCCTGAGG - Intergenic
1035705985 8:1675305-1675327 TCAGGAGCGCGCCCTGGTTGGGG - Intronic
1036121370 8:6021086-6021108 TCTGCAGAGCATCCTGGAAGGGG + Intergenic
1036701466 8:11016268-11016290 TCTGCCCCGCGCCCTGGATGGGG + Intronic
1037952279 8:23027331-23027353 CCTGCAGCGAGCCCTAGGTGTGG - Intronic
1040284495 8:46092952-46092974 TCTGGGGCACTTCCTGGGTGGGG + Intergenic
1040318378 8:46276760-46276782 TCTGGAGCACCCCCTGGGTGGGG - Intergenic
1040319872 8:46287094-46287116 CCTCCAGCGCCCCCTGGGTGGGG - Intergenic
1040832043 8:51688404-51688426 TCTGCAGTGTGTTCTGTGTGTGG - Intronic
1041543301 8:59011359-59011381 TCTGCAGCCTTTCCTGGGTAGGG - Intronic
1046256355 8:111701261-111701283 TCTGCAGGGGATCCTGAGTGTGG + Intergenic
1048995571 8:139791886-139791908 TCTGCAGCGCGCGTGGGGTGGGG + Intronic
1049389803 8:142361844-142361866 TCTGCAGCGGGGTCTGGCTGTGG - Intronic
1049526875 8:143131318-143131340 TCAGTAGCCCCTCCTGGGTGAGG - Intergenic
1049718098 8:144103156-144103178 GCTGTAGCTCGTGCTGGGTGGGG + Exonic
1049784752 8:144444841-144444863 GTCGCAGCGCGCCCTGGGTGGGG + Intergenic
1050652013 9:7786350-7786372 TCTGCAGGGGGTCCTCGGTAAGG + Intergenic
1051911472 9:22156948-22156970 TTTTAAGCGCGTCCTGGGTTGGG + Intergenic
1055760261 9:79599413-79599435 TCTGGAGTGAGGCCTGGGTGTGG + Intronic
1056992293 9:91423579-91423601 CCCGCAGCGCGCCCTGGGAGCGG + Intronic
1061307614 9:129741110-129741132 TCTGCAGCGTGCCTGGGGTGGGG + Intronic
1062416539 9:136454096-136454118 TCTGCAGCCCCACCTGGGTCTGG + Exonic
1189180956 X:39004120-39004142 TCTTCAGCGAGTCCAGGCTGTGG + Intergenic
1189251002 X:39600710-39600732 TCTGCAGCCCGGCCTGGGCAGGG + Intergenic
1190113394 X:47609732-47609754 TCTGCAGCAGGTCCGGGCTGTGG + Intronic
1190113722 X:47612043-47612065 TCTGCAGCAGGTCCAGGCTGTGG + Intronic
1197345074 X:125320497-125320519 GCTGCAGGGCGGCCTGCGTGAGG - Intergenic
1199599592 X:149534104-149534126 CCTGCAGCGCTTCATGGGAGGGG - Intergenic
1199651041 X:149946106-149946128 CCTGCAGCGCTTCATGGGAGGGG + Intergenic
1200236540 X:154470432-154470454 TCTGCAGTGTGCCCTGTGTGGGG - Exonic