ID: 1180783506

View in Genome Browser
Species Human (GRCh38)
Location 22:18534702-18534724
Sequence CGGCCTGAACAAAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 3, 1: 0, 2: 1, 3: 17, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180783506_1180783516 12 Left 1180783506 22:18534702-18534724 CCATCCTCCCTTTGTTCAGGCCG 0: 3
1: 0
2: 1
3: 17
4: 236
Right 1180783516 22:18534737-18534759 CCACCTCTGACTCCCACAGCAGG 0: 3
1: 0
2: 3
3: 92
4: 545
1180783506_1180783517 13 Left 1180783506 22:18534702-18534724 CCATCCTCCCTTTGTTCAGGCCG 0: 3
1: 0
2: 1
3: 17
4: 236
Right 1180783517 22:18534738-18534760 CACCTCTGACTCCCACAGCAGGG 0: 3
1: 0
2: 1
3: 38
4: 389
1180783506_1180783521 28 Left 1180783506 22:18534702-18534724 CCATCCTCCCTTTGTTCAGGCCG 0: 3
1: 0
2: 1
3: 17
4: 236
Right 1180783521 22:18534753-18534775 CAGCAGGGAGCCTGTCAGCCCGG 0: 3
1: 0
2: 2
3: 49
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180783506 Original CRISPR CGGCCTGAACAAAGGGAGGA TGG (reversed) Intergenic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903160998 1:21489103-21489125 TGGTCTGGACACAGGGAGGAAGG + Intergenic
903429836 1:23287045-23287067 AGGCAAGAAGAAAGGGAGGAGGG - Intergenic
903610507 1:24608311-24608333 TGGGCTGAACAAGGGGAGTACGG + Exonic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904395591 1:30219361-30219383 TGGCCGGAGCAAAGGGAGCAGGG + Intergenic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG + Intronic
905316710 1:37086563-37086585 GGGCCTGAACAGACGGAGGCAGG - Intergenic
905809206 1:40899571-40899593 CTGCCTCAAAGAAGGGAGGAAGG - Intergenic
906048240 1:42849642-42849664 TGACATGAACAAAGGGATGAGGG - Exonic
906107367 1:43302835-43302857 AGGGCTGAACAAAGGCAGGCTGG + Intronic
907652930 1:56312817-56312839 TGACCTGAAAAAAGAGAGGAAGG + Intergenic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
910962562 1:92778291-92778313 CTGCCAGAACAAAGAGTGGAAGG + Intronic
911044291 1:93615900-93615922 AGGCCTGAGAAAAGGGAGGGGGG + Intronic
911462263 1:98205865-98205887 AGGACGGAACAAAGGAAGGAAGG + Intergenic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912864877 1:113248072-113248094 AGGCCAGAAGAAAGAGAGGATGG + Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919535760 1:198785967-198785989 CAGCCAGAAGAAAGGGAGAAGGG + Intergenic
920596838 1:207280236-207280258 CTGCCTGAAGAAGGGGATGAAGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
923093032 1:230753857-230753879 AGACCTAAACAAAGGGAGGGAGG - Intronic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
1063367407 10:5499601-5499623 CAATCGGAACAAAGGGAGGAGGG + Intergenic
1063947847 10:11194580-11194602 CGAGCTGCACAAAGGGAAGATGG + Intronic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067666988 10:48287492-48287514 TGGCATGAACACGGGGAGGACGG + Intergenic
1069589740 10:69634387-69634409 GGGCCTGGACAAAGAGAGGTGGG + Intergenic
1070456551 10:76622906-76622928 CGGCCTGAATCAGGGAAGGAGGG + Intergenic
1070772705 10:79091686-79091708 CGGCATGACCAAAGGAAGGGAGG + Intronic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1070992563 10:80745368-80745390 CGTCCTCATCAAAGGGTGGAAGG + Intergenic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1071515243 10:86292610-86292632 GGCCCTGAAGAGAGGGAGGAAGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1075873690 10:125789360-125789382 GGGTCTGATCAAGGGGAGGATGG + Intronic
1076604604 10:131681306-131681328 CTGCCTGCTCCAAGGGAGGAAGG - Intergenic
1077253598 11:1571357-1571379 CGGCCTGGACACTGGGGGGATGG + Intronic
1078470490 11:11582142-11582164 AGGGCTGAACAAAGTGAAGAGGG + Intronic
1079557657 11:21780610-21780632 CAGCCTGAAATAAGGGAGAAAGG + Intergenic
1080120507 11:28671638-28671660 AGGCCTGGAAAAAGGGAGAAAGG - Intergenic
1080557337 11:33429715-33429737 TGGCCTGAACAATGGAAGGAGGG - Intergenic
1080573916 11:33580954-33580976 CCACCTGAAGAAAGGGAGGGAGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081421686 11:42879022-42879044 GGGCCTGACCAAAGAGATGAGGG - Intergenic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1083784304 11:64934981-64935003 TGGCCTGAAGAAGGTGAGGAGGG - Exonic
1085386611 11:76161498-76161520 CGGCCTGTCCGAGGGGAGGAAGG - Intergenic
1085403474 11:76248104-76248126 AGGGCTGAGCTAAGGGAGGAGGG - Intergenic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1088021897 11:105130191-105130213 TGGCCAGAACAAAGGGGGAAAGG + Intergenic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1091803867 12:3342410-3342432 CAGCCTGAACAAAGGGCCAAAGG - Intergenic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1096821272 12:54236927-54236949 TGGCCTGAACATAGGGAAAATGG + Exonic
1097281293 12:57846602-57846624 CGGCCTGTACAAAGGGCGGGCGG + Exonic
1098025335 12:66195119-66195141 TGGCCTGAACAAATGAAGAATGG - Intronic
1100361579 12:93884505-93884527 CCACCTGCACACAGGGAGGACGG + Intronic
1102212296 12:111136314-111136336 TGGCCTGAACTATGGGAGGATGG + Intronic
1105793265 13:23823951-23823973 CTGCCTTACCAAAGAGAGGAAGG + Intronic
1106937160 13:34735651-34735673 TGGCCTGAACAACTGGAGAATGG - Intergenic
1112530405 13:100196972-100196994 GGGCATCAACAAAGGTAGGAAGG - Intronic
1115157458 14:30357253-30357275 AGGCCTGGAGAAAGGGAGGGAGG - Intergenic
1116805939 14:49494054-49494076 TGGCCTTAAAAAAGGGGGGAGGG + Intergenic
1117051105 14:51860407-51860429 GGACTTGAACAAAGGGAGAAGGG + Exonic
1118464060 14:66014841-66014863 CTGCCTGAAAATAGAGAGGAGGG + Intergenic
1118550588 14:66945346-66945368 TGGCCTGCACACTGGGAGGATGG - Intronic
1120666371 14:87311234-87311256 CGGCCGGAAGGAAGGAAGGACGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1123415703 15:20093490-20093512 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1123525042 15:21100604-21100626 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1123722441 15:23071469-23071491 TGGCCTGAATAAAGTGAAGATGG + Intergenic
1126193437 15:45903517-45903539 AGGCAAGAAGAAAGGGAGGAAGG - Intergenic
1127068922 15:55268978-55269000 AGACATGAACACAGGGAGGATGG + Intronic
1127469341 15:59276401-59276423 CACACTGTACAAAGGGAGGAGGG + Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129849142 15:78781776-78781798 TGGCCTGAAGATGGGGAGGAGGG - Intronic
1130554900 15:84915749-84915771 CGGCCAGAAGAGAGGCAGGATGG - Intronic
1130654026 15:85779342-85779364 CTGCCTGACCAAAGTGAGCAGGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1135788091 16:25368387-25368409 CGGCCTGCACACTGGGAGAATGG + Intergenic
1139253521 16:65519521-65519543 AGGAAGGAACAAAGGGAGGAGGG - Intergenic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1140210174 16:72963267-72963289 CGGGCTGCAGGAAGGGAGGAGGG - Intronic
1141466329 16:84208154-84208176 GGGCCTGCCCTAAGGGAGGAGGG - Intergenic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1144793241 17:17873610-17873632 CGGCCTGATGGAAGGGAGCAGGG + Intronic
1146260311 17:31416420-31416442 CGGCCTGAGACAAGGGATGAGGG - Intronic
1146468875 17:33108701-33108723 CAGCCTGAAGAAAGGTACGATGG + Intronic
1147539476 17:41345109-41345131 AGGCAGGAACAAAGAGAGGAAGG + Intergenic
1148326464 17:46786101-46786123 AAGCCTGGAAAAAGGGAGGAGGG + Intronic
1151451693 17:74201967-74201989 CTGCCTGAAAAAGGGGAGGCGGG + Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1159045654 18:63366917-63366939 CGGCCTGGAAAAAGGGACGTAGG + Intronic
1159672223 18:71235788-71235810 AGGCAGGAAGAAAGGGAGGAAGG + Intergenic
1160379338 18:78439638-78439660 GGGCCAGGACAAAGGGAAGAGGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1163878874 19:19900490-19900512 CACCCTGAACAAAGGAGGGAAGG - Intergenic
1164969533 19:32519560-32519582 TGGCCTGAACAACGGGATAAAGG - Intergenic
1164969724 19:32521285-32521307 TGGCCTGAACAACGGGATAAAGG - Intergenic
1165162951 19:33828725-33828747 TGGCCTGAGCAAAGGAAGGATGG + Intergenic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167158996 19:47755587-47755609 GTTCCTGAACAAAGGCAGGAAGG - Intronic
1168505673 19:56932805-56932827 AGGTCGGAACAAAGGGAGGGAGG - Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927906378 2:26861405-26861427 CTGCCTGAAGGAAGGGATGAAGG - Intronic
928322468 2:30294810-30294832 AGACCTGGACAAGGGGAGGAAGG + Intronic
928756414 2:34531090-34531112 CAGCCTAAAGAAAGGGAGCATGG + Intergenic
928772009 2:34714159-34714181 TGGCTTGAACAAAAGGAGAAGGG - Intergenic
928923635 2:36553682-36553704 TGGCCTGAGAAAAGGGAGTAGGG - Intronic
930021642 2:47005209-47005231 CGGGCTGGACACAGAGAGGAAGG + Intronic
931644349 2:64408105-64408127 AGGCCTGGCCATAGGGAGGAGGG + Intergenic
932046776 2:68357804-68357826 CGGCCTGTGCACTGGGAGGATGG - Intergenic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
933639202 2:84741276-84741298 GGGCCTGAAAACAGGGAGGGCGG + Intronic
934980277 2:98833744-98833766 CTGCCTGAACAATAGGTGGAAGG + Intronic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
937869851 2:126779020-126779042 CTCCCTGAACAAAGGGAGTGGGG - Intergenic
938099624 2:128489823-128489845 CTGCCAGGAGAAAGGGAGGAAGG - Intergenic
945170444 2:206989581-206989603 CAGCCTGATGAAAGGTAGGAGGG + Intergenic
946753738 2:222920946-222920968 AGGCCTGAATAAAGTGAGGAAGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1168848401 20:960434-960456 CGGCCAGAAGAAGGGCAGGAAGG - Exonic
1169109196 20:3021030-3021052 CGCCCTGAACCAAGGGAGTGTGG + Intronic
1169748959 20:8972322-8972344 TGGCATGAAAAAAAGGAGGAGGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172293716 20:33793367-33793389 CGGCCTGCACAAAGGCCCGAGGG + Intergenic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173880659 20:46409464-46409486 TGGCCTGAATAAAGTGAAGATGG - Intronic
1174544132 20:51312587-51312609 CTGCCTGAGCACTGGGAGGATGG - Intergenic
1175293699 20:57894740-57894762 GGGAAGGAACAAAGGGAGGAAGG + Intergenic
1176512574 21:7759769-7759791 AGGCCCTGACAAAGGGAGGATGG - Intronic
1178561224 21:33641754-33641776 CGGCCTGACCAATGGGAGCAGGG - Exonic
1178646687 21:34390293-34390315 AGGCCCTGACAAAGGGAGGATGG - Intronic
1179049250 21:37874721-37874743 AGGCCTGAGCAAATGGAAGAAGG - Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1180006706 21:45026002-45026024 AGTCCTTAACAAACGGAGGATGG + Intergenic
1180617103 22:17135503-17135525 CGGCCTAGACAAGGAGAGGAAGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181531878 22:23521729-23521751 CGCCCGGAACAAAGGCAGGCCGG + Intergenic
1181534457 22:23534359-23534381 TGACGTGAACAAAGGGAGGGTGG - Intergenic
1182104435 22:27679329-27679351 CTGCCTGAACGGAGGAAGGATGG + Intergenic
1182455253 22:30446338-30446360 TGGCCTGAGCAAAGGCAGGGAGG - Intergenic
1182544383 22:31065989-31066011 AGGCCTGAACACAGGCAGGAAGG - Intronic
1182698119 22:32209903-32209925 GGGACTGAACAATGGGAGGGAGG - Intergenic
1183085417 22:35483829-35483851 AGGAAGGAACAAAGGGAGGAAGG + Intergenic
1184887345 22:47354509-47354531 CGGCTTGGACAAAGAGAGGATGG - Intergenic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
950714311 3:14836920-14836942 CGACCTGAAGAAGGGAAGGAAGG + Intronic
952743067 3:36752627-36752649 AGACCTGAACAAAGGCAGGAAGG - Intergenic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
956735491 3:72234470-72234492 TTCCCTGGACAAAGGGAGGAAGG - Intergenic
958983157 3:100748480-100748502 AGCCCTGACCAAAGGGAGGACGG - Exonic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
959572939 3:107904906-107904928 TGGCCTGCACACTGGGAGGATGG - Intergenic
961202652 3:125056500-125056522 GGGCCTGAAGAAGGGGAGGTGGG - Intergenic
961397910 3:126609898-126609920 CGGCCTTTCCAAAGGGAGTAGGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
963000580 3:140678121-140678143 CGGCCTCAGGAATGGGAGGAAGG + Exonic
965240210 3:166187404-166187426 TGGCCTGCACACTGGGAGGATGG - Intergenic
965390301 3:168095779-168095801 CGGCCTGCCCAATGGGTGGAAGG + Exonic
970808577 4:20064460-20064482 AGGATTGAATAAAGGGAGGATGG + Intergenic
975783654 4:77865382-77865404 TGGCCTGGACAAATGAAGGATGG - Intronic
976472670 4:85447814-85447836 CTGCCAGGAGAAAGGGAGGAAGG + Intergenic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
977152074 4:93525305-93525327 GGGCCTGAGCAAAGGCATGAAGG + Intronic
978328515 4:107586489-107586511 TGGCCTGCACACTGGGAGGATGG - Intergenic
978755999 4:112303530-112303552 TGGCCTGAACCAAGTGAGAATGG - Intronic
984376728 4:178940120-178940142 CGGCCTGCACATGGGGAAGAAGG + Intergenic
984490685 4:180431072-180431094 AGGCCTGAGCACAGGGAGTAAGG - Intergenic
985179332 4:187239555-187239577 AGGCAGGTACAAAGGGAGGAAGG - Intergenic
985523184 5:388688-388710 CGTCCTGGCCAATGGGAGGACGG - Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989517556 5:42361083-42361105 ATGCCTGAACAAGGGGAGGCAGG - Intergenic
995850017 5:116535103-116535125 TGGCCTGAAGGAAGGAAGGAGGG + Intronic
996526388 5:124484588-124484610 AGGCCTGAGGAAAGGGAGAAAGG + Intergenic
996709025 5:126525731-126525753 CAGCCTGCACACTGGGAGGATGG + Intergenic
996823562 5:127656627-127656649 CTGCCTGAGCCAAGGGAGAACGG - Intronic
999843091 5:155449879-155449901 CAGCCACAACAATGGGAGGAAGG - Intergenic
1000038174 5:157464599-157464621 CGGCTTCAAGCAAGGGAGGAGGG + Intronic
1000330526 5:160201681-160201703 CTTCCTGAAGAAAGAGAGGAGGG - Intronic
1000445582 5:161314710-161314732 GGGAAAGAACAAAGGGAGGAAGG - Intronic
1000978155 5:167787509-167787531 GGCCCTGAACAAAGTGAGAAGGG - Intronic
1001098496 5:168794862-168794884 TGGCCTAAAGAAAGGAAGGAAGG - Intronic
1002045569 5:176539920-176539942 TAGCCTGAGCAAAGGCAGGAAGG - Intergenic
1003456463 6:6287310-6287332 TGGTCTGAACTCAGGGAGGACGG - Intronic
1004398835 6:15270100-15270122 CGGACTGAAGGAAGGAAGGAAGG - Intronic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1006523447 6:34585406-34585428 AGACCTGAAGAATGGGAGGATGG - Intergenic
1007181606 6:39933026-39933048 TGGCCTCCACACAGGGAGGACGG + Intronic
1007321607 6:41032217-41032239 AGGACAGAACAAAGGCAGGAGGG + Intronic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1013588428 6:111599739-111599761 GGACCTGAAGAAAGGGAGGCAGG - Intronic
1013703600 6:112805102-112805124 GGGACTGAAGAAAGGGAGGGAGG - Intergenic
1014135117 6:117879972-117879994 AGGCATGAACGCAGGGAGGAAGG - Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015496582 6:133889559-133889581 CGGCCTGGGCAAGAGGAGGAAGG + Exonic
1015724810 6:136289388-136289410 CGGGCTGAAGAAATGGGGGAAGG + Intronic
1017355183 6:153496737-153496759 AGGCCTGAAAAAAGGGAGGAAGG - Intergenic
1021143593 7:17057395-17057417 TGGCCTAAACAAATGCAGGATGG + Intergenic
1021824540 7:24535834-24535856 CGGCCTGAGCACAGGAAGCATGG - Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1022679050 7:32526943-32526965 TGGCCTGCACACTGGGAGGATGG - Intronic
1023498575 7:40824377-40824399 AGGCAAGAACAGAGGGAGGAGGG + Intronic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029705626 7:102274319-102274341 AGGCCTGACCCATGGGAGGAGGG + Intronic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032580090 7:133096304-133096326 TGGCCTGCACACTGGGAGGATGG - Intergenic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1034140676 7:148812661-148812683 CTTTCTGAACAAAGTGAGGAAGG + Intronic
1035276535 7:157751283-157751305 CGCACTGGACAAAGTGAGGATGG + Intronic
1036645980 8:10611642-10611664 CGGCCTGAGCAAGGGGCGGTGGG - Exonic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1039033390 8:33333185-33333207 AGGCCTGAGGAAAGTGAGGAAGG + Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1042615169 8:70640546-70640568 CAGCCTGCACCAAGAGAGGAGGG - Intronic
1042829610 8:73012148-73012170 AGGCCTGAAGAGAGGGAGTAAGG + Intronic
1045515053 8:102852123-102852145 TGGCATGACCAAAGGTAGGATGG - Intronic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1047192810 8:122693672-122693694 CAGCCTGAACATAGAGAGGCAGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048775417 8:137940538-137940560 TGGCCCGAGCAAAGGGAAGAGGG + Intergenic
1050537191 9:6641155-6641177 CGGACAGAACCAGGGGAGGACGG - Intronic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1055968005 9:81884041-81884063 CAGCCTGAGCCAAGTGAGGAAGG - Intergenic
1056032530 9:82567795-82567817 CGGCCTTAAAAAAGGGATGGTGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1060385907 9:123228121-123228143 TGGCCTAAACAACCGGAGGATGG + Intronic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060688580 9:125635439-125635461 CAGCCTGAACATAGGGTGGAAGG - Intronic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1192159230 X:68770301-68770323 CTGCCTGAAGTAAGGGAGGTGGG - Intergenic
1193534905 X:82702139-82702161 TTGCATGAACAAAGGGAGGGTGG - Intergenic
1195861703 X:109390007-109390029 CAGCCTGCACACAGGAAGGAAGG + Intronic
1197820773 X:130538839-130538861 AAGCCTAAACAAAGTGAGGAGGG + Intergenic
1200891448 Y:8328695-8328717 GGCCCTGCACAAAGGAAGGATGG + Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic
1202039178 Y:20664879-20664901 CAGCCTGAAAAAGGGAAGGAAGG - Intergenic