ID: 1180783707

View in Genome Browser
Species Human (GRCh38)
Location 22:18535522-18535544
Sequence GGGGCCACTCAGGTGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180783707_1180783719 4 Left 1180783707 22:18535522-18535544 CCCAGCATCACCTGAGTGGCCCC No data
Right 1180783719 22:18535549-18535571 CATTAGGGGACTAAGCATTGGGG 0: 2
1: 1
2: 0
3: 6
4: 87
1180783707_1180783718 3 Left 1180783707 22:18535522-18535544 CCCAGCATCACCTGAGTGGCCCC No data
Right 1180783718 22:18535548-18535570 GCATTAGGGGACTAAGCATTGGG 0: 2
1: 1
2: 1
3: 13
4: 384
1180783707_1180783717 2 Left 1180783707 22:18535522-18535544 CCCAGCATCACCTGAGTGGCCCC No data
Right 1180783717 22:18535547-18535569 GGCATTAGGGGACTAAGCATTGG 0: 2
1: 1
2: 2
3: 10
4: 368
1180783707_1180783713 -10 Left 1180783707 22:18535522-18535544 CCCAGCATCACCTGAGTGGCCCC No data
Right 1180783713 22:18535535-18535557 GAGTGGCCCCATGGCATTAGGGG 0: 2
1: 0
2: 2
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180783707 Original CRISPR GGGGCCACTCAGGTGATGCT GGG (reversed) Intergenic
No off target data available for this crispr