ID: 1180784528

View in Genome Browser
Species Human (GRCh38)
Location 22:18539432-18539454
Sequence AGTGATCCCCAAGATTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180784528_1180784531 -6 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784531 22:18539449-18539471 ATCACTTCTTCAAAACCCCAAGG No data
1180784528_1180784534 6 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784534 22:18539461-18539483 AAACCCCAAGGAGGCCAAGGAGG No data
1180784528_1180784532 -3 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784532 22:18539452-18539474 ACTTCTTCAAAACCCCAAGGAGG No data
1180784528_1180784539 18 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784539 22:18539473-18539495 GGCCAAGGAGGAGCCCAGCAGGG No data
1180784528_1180784533 3 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784533 22:18539458-18539480 TCAAAACCCCAAGGAGGCCAAGG No data
1180784528_1180784538 17 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784538 22:18539472-18539494 AGGCCAAGGAGGAGCCCAGCAGG No data
1180784528_1180784541 25 Left 1180784528 22:18539432-18539454 CCCCAGCAATCTTGGGGATCACT No data
Right 1180784541 22:18539480-18539502 GAGGAGCCCAGCAGGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180784528 Original CRISPR AGTGATCCCCAAGATTGCTG GGG (reversed) Intergenic
No off target data available for this crispr