ID: 1180785887

View in Genome Browser
Species Human (GRCh38)
Location 22:18547564-18547586
Sequence CTGTGGGCAGTGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180785887_1180785900 24 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785887_1180785897 14 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785887_1180785901 29 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785887_1180785899 23 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180785887 Original CRISPR CTGTGGGCAGTGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr