ID: 1180785897

View in Genome Browser
Species Human (GRCh38)
Location 22:18547601-18547623
Sequence TTCCACTGAAGCTGCACTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180785892_1180785897 -2 Left 1180785892 22:18547580-18547602 CCCACAGCAGCCCCTACAGCTTT 0: 3
1: 0
2: 1
3: 22
4: 205
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785888_1180785897 13 Left 1180785888 22:18547565-18547587 CCTCCTCCCTCACTGCCCACAGC No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785893_1180785897 -3 Left 1180785893 22:18547581-18547603 CCACAGCAGCCCCTACAGCTTTC 0: 3
1: 0
2: 1
3: 24
4: 252
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785889_1180785897 10 Left 1180785889 22:18547568-18547590 CCTCCCTCACTGCCCACAGCAGC No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785885_1180785897 24 Left 1180785885 22:18547554-18547576 CCCTCTTATGCCCTCCTCCCTCA No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785890_1180785897 7 Left 1180785890 22:18547571-18547593 CCCTCACTGCCCACAGCAGCCCC No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785887_1180785897 14 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785886_1180785897 23 Left 1180785886 22:18547555-18547577 CCTCTTATGCCCTCCTCCCTCAC No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data
1180785891_1180785897 6 Left 1180785891 22:18547572-18547594 CCTCACTGCCCACAGCAGCCCCT No data
Right 1180785897 22:18547601-18547623 TTCCACTGAAGCTGCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180785897 Original CRISPR TTCCACTGAAGCTGCACTTG TGG Intergenic
No off target data available for this crispr