ID: 1180785899

View in Genome Browser
Species Human (GRCh38)
Location 22:18547610-18547632
Sequence AGCTGCACTTGTGGCAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 3, 1: 0, 2: 1, 3: 13, 4: 125}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180785887_1180785899 23 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785896_1180785899 -5 Left 1180785896 22:18547592-18547614 CCTACAGCTTTCCACTGAAGCTG 0: 3
1: 0
2: 1
3: 14
4: 231
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785892_1180785899 7 Left 1180785892 22:18547580-18547602 CCCACAGCAGCCCCTACAGCTTT 0: 3
1: 0
2: 1
3: 22
4: 205
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785893_1180785899 6 Left 1180785893 22:18547581-18547603 CCACAGCAGCCCCTACAGCTTTC 0: 3
1: 0
2: 1
3: 24
4: 252
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785895_1180785899 -4 Left 1180785895 22:18547591-18547613 CCCTACAGCTTTCCACTGAAGCT 0: 3
1: 0
2: 1
3: 54
4: 514
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785890_1180785899 16 Left 1180785890 22:18547571-18547593 CCCTCACTGCCCACAGCAGCCCC No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785891_1180785899 15 Left 1180785891 22:18547572-18547594 CCTCACTGCCCACAGCAGCCCCT No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785889_1180785899 19 Left 1180785889 22:18547568-18547590 CCTCCCTCACTGCCCACAGCAGC No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785894_1180785899 -3 Left 1180785894 22:18547590-18547612 CCCCTACAGCTTTCCACTGAAGC 0: 3
1: 0
2: 2
3: 13
4: 132
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125
1180785888_1180785899 22 Left 1180785888 22:18547565-18547587 CCTCCTCCCTCACTGCCCACAGC No data
Right 1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180785899 Original CRISPR AGCTGCACTTGTGGCAGATC AGG Intergenic
903413590 1:23167280-23167302 AGCTGGACTGGTGTCAGAGCCGG - Intronic
903799274 1:25954603-25954625 AGCAGCATTTCAGGCAGATCTGG + Intergenic
907661792 1:56400048-56400070 AACTGAACTTGAGGCAGATCCGG + Intergenic
908287105 1:62618790-62618812 AGCTTCACTTGAAGCAGCTCCGG + Exonic
912602616 1:110952608-110952630 TGATGCACTTGTGGAAGAGCTGG + Exonic
915714101 1:157927914-157927936 AGCTGAACCTCTGGCAAATCTGG - Intergenic
920715059 1:208332457-208332479 AGGGGCACTTTTGGCAGAGCAGG + Intergenic
920770321 1:208878577-208878599 AGTTCCTCTTCTGGCAGATCAGG - Intergenic
923099669 1:230802434-230802456 TGGTACACTTGTGGCAGATGAGG + Intergenic
923519424 1:234724600-234724622 ATCTGCTCATGTGGCACATCTGG - Intergenic
1062953802 10:1526605-1526627 AGCTTCACTCGTGGCCGATGGGG - Intronic
1065513282 10:26500850-26500872 AGATGCTCTCATGGCAGATCTGG + Exonic
1070558565 10:77548555-77548577 AGCTGACCTGGTGGCAGCTCAGG + Intronic
1070872531 10:79769292-79769314 AGCTGCACTTGTGGAGGAGGAGG + Intergenic
1071639452 10:87291444-87291466 AGCTGCACTTGTGGAAGAGGAGG + Intergenic
1071655784 10:87446505-87446527 AGCTGCACTTGTGGAGGAGGAGG - Intergenic
1074645040 10:115440087-115440109 AGCTGAAATTGTTCCAGATCTGG + Intronic
1077154556 11:1085571-1085593 GGCTGCACTGTAGGCAGATCCGG + Intergenic
1081407351 11:42713423-42713445 AGCTGAACTTATTGCATATCTGG - Intergenic
1089051754 11:115551423-115551445 AGCTGCATTTGTGGAAGTTTGGG + Intergenic
1095645318 12:44538574-44538596 AGCTGCACTTTGGGAAGAACAGG + Intronic
1097730593 12:63123813-63123835 AGCTGGCCCTGTGGGAGATCTGG + Intergenic
1098069352 12:66655389-66655411 GGCTGCACATGTGGCAGGGCAGG - Intronic
1099436947 12:82657084-82657106 AGCTGAGCTTGTGGCAGAGGAGG + Intergenic
1102782178 12:115574895-115574917 AGGTGCATTTGTGGGAGACCTGG - Intergenic
1106484331 13:30159088-30159110 AGCTGCACTTGTTGAAGATCGGG - Intergenic
1111923189 13:94433920-94433942 AGCTACACTTAGTGCAGATCTGG - Intergenic
1113439108 13:110314053-110314075 AGCTGCACTAGTGGAAAAACTGG + Intronic
1113533641 13:111047059-111047081 AGCTCCCCTTGTGGCAGCACAGG + Intergenic
1115536136 14:34375155-34375177 AGCTGCCATTGTGGAAGAACCGG - Intronic
1116981628 14:51176963-51176985 AGCTGCCCTCGTGGGAGGTCGGG - Intergenic
1122669022 14:103355680-103355702 AGCTGCTCTTGTGGCAGCCTGGG + Intergenic
1123053632 14:105559472-105559494 GGCTGCACCTGGGGCAGATGGGG - Intergenic
1123078211 14:105679887-105679909 GGCTGCACCTGGGGCAGATGGGG - Intergenic
1125832848 15:42728788-42728810 GGCTACACTGGTGGCAGATCTGG - Exonic
1127668362 15:61171153-61171175 AGCTGCCCGTGGGGCAGGTCTGG - Intronic
1129170233 15:73803087-73803109 AGCAGCACTTGAGGCTGGTCGGG - Intergenic
1132377358 15:101338375-101338397 AGCAGCACTTGTGCCAGGACAGG + Intronic
1133421952 16:5653628-5653650 AGCTGCACATGCGGCAGAACAGG - Intergenic
1135024391 16:18987976-18987998 AGCTGCGCTTGTGGTGGAGCTGG + Intronic
1135315665 16:21442502-21442524 AGCTGCGCTTGTGGTGGAGCTGG - Intronic
1135368591 16:21874763-21874785 AGCTGCGCTTGTGGTGGAGCTGG - Intronic
1135443226 16:22496379-22496401 AGCTGCGCTTGTGGTGGAGCTGG + Intronic
1136312347 16:29421246-29421268 AGCTGCGCTTGTGGTGGAGCTGG - Intergenic
1136325775 16:29522981-29523003 AGCTGCGCTTGTGGTGGAGCTGG - Intergenic
1136440464 16:30262964-30262986 AGCTGCGCTTGTGGTGGAGCTGG - Intergenic
1138221676 16:55256848-55256870 GGCTGCACTGGTGGAAAATCCGG - Intergenic
1139886973 16:70215300-70215322 AGCTGCGCTTGTGGTGGAGCTGG - Intergenic
1139890498 16:70250847-70250869 AGCTGCGCTTGTGGTGGAGCTGG - Exonic
1140292494 16:73673724-73673746 AGCTGGACTTGGGGCAGAACAGG + Intergenic
1142469678 17:156311-156333 AGCTGTACTTGAGGGAGATGAGG + Exonic
1147477938 17:40731416-40731438 AGTGGCACTTGAGGCAGATTAGG - Intergenic
1150756913 17:67922954-67922976 AACTGGAATTGTGGGAGATCAGG + Exonic
1150927413 17:69547582-69547604 AGCTGCTGTTGAGGCAGATTAGG + Intergenic
1151747705 17:76020439-76020461 AGCTGCACTTGTCCCAGCCCCGG + Intronic
1154193490 18:12249356-12249378 ATCTGCACTTCCGGCAGTTCAGG - Intergenic
1157177544 18:45465344-45465366 AGCTGCACTGTTGGCAGTTGTGG + Intronic
1157519406 18:48334988-48335010 AGCTTCCCCTGTGGCAGAGCTGG + Intronic
1159849928 18:73515382-73515404 AGCTGCACTGGCGGCTGATTAGG - Intergenic
1160371767 18:78378033-78378055 AGCTGCACCTGTGGGTGCTCAGG + Intergenic
1161884596 19:6984436-6984458 AGCTGCCCTTTTGGAAGCTCAGG + Intergenic
1162432022 19:10634855-10634877 ACCTGCACTTACGGCAGACCTGG + Exonic
1163403853 19:17110575-17110597 AGCTGCACTTGCTACAGTTCAGG - Intronic
1163796587 19:19341564-19341586 ACCAGCACTCGTGGCAGAGCAGG - Intronic
1166268501 19:41699693-41699715 CCCTGCTCTCGTGGCAGATCAGG + Intronic
926710668 2:15877088-15877110 AGCTGGATTTGTGACAGAGCAGG + Intergenic
926765520 2:16319974-16319996 AGCTGCACTTCTGAGACATCGGG - Intergenic
927562367 2:24083074-24083096 ATCTGGACATGTGGCAGAGCTGG - Exonic
929005324 2:37387865-37387887 AGCTGTATTTGTGGCAAAGCTGG + Intergenic
929491968 2:42405030-42405052 AGCTGCAGTTGTGTGAGATTTGG - Intronic
932666673 2:73703946-73703968 AGGTGCACTTGGGGCAGAAATGG + Intergenic
934059425 2:88280357-88280379 ACCTGGACTTGTAGCACATCTGG + Intergenic
934063896 2:88321735-88321757 AGCAGCCCCTGTGGCAGCTCAGG + Intergenic
934700828 2:96438843-96438865 AGCTTCAGTTGTGGCAAATAGGG + Intergenic
935125320 2:100217602-100217624 AGCAGCTCTTGGGGCAGAGCTGG - Intergenic
935130777 2:100259305-100259327 AGCTTCTCATTTGGCAGATCTGG + Intergenic
937309368 2:120892617-120892639 TGCTGCGCTGGTGGCAGTTCAGG + Intronic
938482539 2:131673589-131673611 AGCAGCATTGGTGGCAGCTCTGG - Intergenic
942579496 2:177402303-177402325 AAATGCACATGTGGCATATCAGG + Intronic
945817663 2:214625557-214625579 AGCTGCTATTGTGGCATATTGGG + Intergenic
946136292 2:217650319-217650341 AGCCGAACATGTGGCAGAACTGG + Intronic
1170624538 20:18021296-18021318 AGCTTCACATGAGGCAGAGCAGG + Intronic
1173644046 20:44622634-44622656 AGCTGGACCAGGGGCAGATCTGG + Exonic
1175465005 20:59184955-59184977 AGCTGCACACGCGGCAGATGAGG + Intergenic
1179447706 21:41444792-41444814 AGATGCCCTTGTGGCTGAGCCGG + Intronic
1180227196 21:46401441-46401463 AGCTGCACCTGAAGCAGAGCAGG - Intronic
1180785899 22:18547610-18547632 AGCTGCACTTGTGGCAGATCAGG + Intergenic
1181131185 22:20733335-20733357 AGCTGCACTTGTGGCAGATCAGG + Intronic
1181242824 22:21487164-21487186 AGCTGCACTTGTGGCAGATCAGG + Intergenic
1182049629 22:27302833-27302855 AGCTGCCGTTGTGGCAGCTGTGG + Intergenic
1184029645 22:41884588-41884610 ACCTGCAATTGTGACAGCTCTGG + Intronic
1185244461 22:49765762-49765784 AGCTGCACCTGAGGCAGGGCTGG + Intergenic
1185244483 22:49765833-49765855 AGCTGCACCTGAGGCAGGGCTGG + Intergenic
1185244505 22:49765904-49765926 AGCTGCACCTGAGGCAGGGCTGG + Intergenic
959306563 3:104674277-104674299 AGCTGGGCTTGTGGAAGACCAGG - Intergenic
960674842 3:120183916-120183938 AGCTTTAGTTGTGACAGATCAGG - Intronic
961179666 3:124866720-124866742 AGCTGCAGGTGTGGCTGGTCAGG - Intronic
963641286 3:147863988-147864010 GGCTGAGCTTGTGGCAGATAAGG - Intergenic
964156944 3:153597663-153597685 AGCTGCACTTATTGCTGACCAGG + Intergenic
965206458 3:165724285-165724307 AAGTGCACTTGTGACAGATCAGG + Intergenic
968734138 4:2286417-2286439 AGATGCAGTTGTGGCAGGTGTGG - Intronic
969146063 4:5125172-5125194 AGCTGCTCTTGTTGGACATCTGG - Intronic
970578300 4:17448961-17448983 AGCTGGACTGGTGACAGCTCAGG + Intergenic
974543925 4:63275611-63275633 AGCAGCACTTGTGCCACAGCAGG - Intergenic
974543936 4:63275685-63275707 TGCTGCACTTGTGCCAGAAATGG - Intergenic
975773070 4:77750846-77750868 ACCTGCACTGTAGGCAGATCAGG - Intronic
982117646 4:152110953-152110975 AGCTGCACTTGTCCCAGCTCTGG - Intergenic
982412667 4:155096842-155096864 AGCTGCACTAGTTGCCGATTTGG + Intergenic
987966111 5:24876723-24876745 AACTGACCTTCTGGCAGATCAGG - Intergenic
998171769 5:139876633-139876655 AGCTGCACTTGTGGGCAGTCGGG - Intronic
999277161 5:150339002-150339024 AGCTGCTCATGTGGAAGATCAGG - Intronic
999296279 5:150461462-150461484 AGCTGCAGTTGTGGGGGATGGGG - Intergenic
1001834523 5:174820342-174820364 AGCTGCACTTCTGGCAGCCCTGG - Intergenic
1002304538 5:178275369-178275391 AGCTTCACAGGTGGCAGAGCTGG - Intronic
1002717281 5:181235368-181235390 AGCTTCACTTGAGAGAGATCTGG + Exonic
1003244417 6:4371863-4371885 TTCTCAACTTGTGGCAGATCAGG - Intergenic
1007956683 6:45924348-45924370 AGGTGTACTTGTAGCATATCTGG - Intronic
1011513408 6:88126279-88126301 AACTGGACCTGTGGCAGCTCTGG - Intergenic
1012917971 6:105191074-105191096 AGCAGCACATGTGGCAGAGCTGG + Intergenic
1014124108 6:117758172-117758194 AGCTGCAACTGTGGCAAAGCAGG + Intergenic
1018838985 6:167505769-167505791 AGCTGCACAGGTGGCATATCAGG - Intergenic
1022505942 7:30908698-30908720 GCCTGGATTTGTGGCAGATCAGG + Intergenic
1023019418 7:35997055-35997077 AGGCTCACTTTTGGCAGATCAGG - Intergenic
1023745228 7:43316940-43316962 AGCTGCACCTGTGCAAGATCGGG + Intronic
1030984858 7:116229581-116229603 AACTGTACTTGGGGCAGTTCTGG + Intronic
1032416000 7:131736093-131736115 AGCTGCATTTGTGCCAGATTTGG - Intergenic
1036608024 8:10324904-10324926 AGCTGCACATGTGTGAGCTCAGG + Intronic
1037228774 8:16628683-16628705 AGCTTCACATGTGGCAGTGCGGG - Intergenic
1037832047 8:22195520-22195542 AGCTGCACTTGTAGCTGCCCAGG - Exonic
1039793957 8:40896787-40896809 AGGTGCATTTGTGGCAGAGGTGG - Intronic
1041444823 8:57939433-57939455 AGCTTCACTTTTGGGTGATCTGG + Intergenic
1046761545 8:118026639-118026661 AGCAGCATTTGTGACAGAACTGG - Intronic
1049402823 8:142437964-142437986 AGCTGGAAATGTGGCAGATTGGG - Intergenic
1051370860 9:16357944-16357966 AGCTGCTCTGGGGGCAGCTCAGG + Intergenic
1053462590 9:38282072-38282094 CGCTGTTCTTGTGGCAGAGCTGG - Intergenic
1056057491 9:82842040-82842062 AGGTCCACTTGTGGCAGCTAAGG - Intergenic
1060848700 9:126857747-126857769 AGCTGGACTTCTGGCAGAAAGGG + Intergenic
1187313528 X:18169514-18169536 ACCTGCACTTGTGGGAGGACTGG - Intronic
1188193968 X:27208042-27208064 AGCCCCACTTGTGGCAGCTAGGG - Intergenic
1193569948 X:83129044-83129066 AGCTGCACTTGCTGGAGATGTGG - Intergenic
1198203196 X:134442315-134442337 AGCTGCACTTGAAACAGATGTGG - Intergenic
1198245281 X:134825058-134825080 GGCTGCACTTGTGTGAGAGCCGG + Intronic