ID: 1180785900

View in Genome Browser
Species Human (GRCh38)
Location 22:18547611-18547633
Sequence GCTGCACTTGTGGCAGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 155}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180785891_1180785900 16 Left 1180785891 22:18547572-18547594 CCTCACTGCCCACAGCAGCCCCT No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785888_1180785900 23 Left 1180785888 22:18547565-18547587 CCTCCTCCCTCACTGCCCACAGC No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785896_1180785900 -4 Left 1180785896 22:18547592-18547614 CCTACAGCTTTCCACTGAAGCTG 0: 3
1: 0
2: 1
3: 14
4: 231
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785890_1180785900 17 Left 1180785890 22:18547571-18547593 CCCTCACTGCCCACAGCAGCCCC No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785892_1180785900 8 Left 1180785892 22:18547580-18547602 CCCACAGCAGCCCCTACAGCTTT 0: 3
1: 0
2: 1
3: 22
4: 205
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785895_1180785900 -3 Left 1180785895 22:18547591-18547613 CCCTACAGCTTTCCACTGAAGCT 0: 3
1: 0
2: 1
3: 54
4: 514
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785893_1180785900 7 Left 1180785893 22:18547581-18547603 CCACAGCAGCCCCTACAGCTTTC 0: 3
1: 0
2: 1
3: 24
4: 252
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785894_1180785900 -2 Left 1180785894 22:18547590-18547612 CCCCTACAGCTTTCCACTGAAGC 0: 3
1: 0
2: 2
3: 13
4: 132
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785887_1180785900 24 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1180785889_1180785900 20 Left 1180785889 22:18547568-18547590 CCTCCCTCACTGCCCACAGCAGC No data
Right 1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180785900 Original CRISPR GCTGCACTTGTGGCAGATCA GGG Intergenic
900735082 1:4294666-4294688 TCTGCACTTGTAGCAGGGCAGGG - Intergenic
902672575 1:17985062-17985084 GCTGGACCTGTGGCAGAGAAAGG + Intergenic
903225973 1:21894447-21894469 GCTGCCCTTGGGGCAGGTCCAGG - Intronic
904782885 1:32964185-32964207 GCTGCACTCGGGGCAGCTGATGG + Exonic
905952612 1:41964640-41964662 ACAGCAGCTGTGGCAGATCATGG + Intronic
906606142 1:47173708-47173730 GCTGAACTTGAGGCAGGGCAAGG + Intergenic
909808830 1:79905875-79905897 GCTGCAGTTGTGGCTGAAAAGGG - Intergenic
909925608 1:81434200-81434222 ACTGTATTTGTGGTAGATCAGGG - Intronic
912469093 1:109894366-109894388 GCTGCACTTGTGGCAGGGAACGG - Intergenic
915024058 1:152811088-152811110 GGTGCCCTTCAGGCAGATCAAGG + Intronic
917682758 1:177384658-177384680 TCAGCAGCTGTGGCAGATCATGG - Intergenic
920553323 1:206884055-206884077 CCTGCACTTTGGGCAGACCAAGG - Intergenic
920715060 1:208332458-208332480 GGGGCACTTTTGGCAGAGCAGGG + Intergenic
922003634 1:221505227-221505249 GCTGCCCCTGGGGCAGAGCAGGG + Intergenic
922034689 1:221836657-221836679 GAACCACTTGTAGCAGATCATGG - Intergenic
924154738 1:241164221-241164243 GCTGAACATGTGGCAGTTCCTGG - Intronic
924331702 1:242946393-242946415 GCTGCAGCAGTGGCAGGTCAGGG - Intergenic
1063790590 10:9441754-9441776 GCTGCATTTTAGGCAGAACAGGG - Intergenic
1066196130 10:33102085-33102107 GCTGCACTTAGGGGAAATCAAGG + Intergenic
1070558566 10:77548556-77548578 GCTGACCTGGTGGCAGCTCAGGG + Intronic
1070855789 10:79607166-79607188 GCTACAGATGTGGCAAATCAGGG - Intergenic
1070872532 10:79769293-79769315 GCTGCACTTGTGGAGGAGGAGGG + Intergenic
1071570826 10:86695900-86695922 GCTGCACTTGTAAGGGATCAGGG - Intronic
1071639453 10:87291445-87291467 GCTGCACTTGTGGAAGAGGAGGG + Intergenic
1071655783 10:87446504-87446526 GCTGCACTTGTGGAGGAGGAGGG - Intergenic
1074788433 10:116862761-116862783 TCTGCAACTGTGGAAGATCATGG + Intronic
1075960684 10:126565617-126565639 TCTGCACTTGTGGTAGCTTAAGG + Intronic
1076633286 10:131865887-131865909 GTTGCACTTGTGGCCGATGCTGG + Intergenic
1087513507 11:99128357-99128379 ACAGCAGCTGTGGCAGATCACGG + Intronic
1088320648 11:108551702-108551724 GCTGAACTTGTAGGAGATCAAGG - Intronic
1089180809 11:116581614-116581636 GCTGTACTTCTGGCAGATCTTGG + Intergenic
1090259503 11:125308495-125308517 GCTGCTCTTGGGAGAGATCATGG - Intronic
1091390526 12:123585-123607 CCTGCACCTCTGGCAGATAAAGG - Intronic
1092590727 12:9951728-9951750 GATGTAGTTGTGGGAGATCAGGG + Intronic
1096188733 12:49600790-49600812 GCTGCACTTCCAGCAGTTCATGG - Exonic
1097498471 12:60373428-60373450 ACAGCAGTTGTGGCAGATCATGG + Intergenic
1099590011 12:84575190-84575212 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1105455847 13:20540471-20540493 GCTGCAGTTGGGCCAGATGATGG + Intergenic
1105792574 13:23816969-23816991 GGCTCACCTGTGGCAGATCATGG - Intronic
1106944835 13:34815661-34815683 TCTGGACTTGAGGCAGATAAGGG - Intergenic
1110475417 13:75907788-75907810 GTTTCACTTTTGGCAGATCCTGG - Intergenic
1112956505 13:105065641-105065663 GCTGCAGACGTGGCAGATCACGG + Intergenic
1113533642 13:111047060-111047082 GCTCCCCTTGTGGCAGCACAGGG + Intergenic
1113923813 13:113929379-113929401 GCTGCACATGTGGCAGCTTCAGG + Intergenic
1114958181 14:27849314-27849336 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1115087972 14:29539786-29539808 GCTGCACCTGTGGGAAATTAGGG + Intergenic
1121745213 14:96283606-96283628 GCTGCAGATGTGGCAAACCACGG + Exonic
1122667390 14:103341101-103341123 GTTGCACTTCTGGCTGATAATGG - Exonic
1124110427 15:26780308-26780330 GGAACACTTGTGGCAGAGCAAGG + Intronic
1131958478 15:97763518-97763540 TCTGTTCTTGTGGCAGATAATGG - Intergenic
1140254924 16:73327285-73327307 ACTGCAGTTGTGGTAGGTCATGG - Intergenic
1140292495 16:73673725-73673747 GCTGGACTTGGGGCAGAACAGGG + Intergenic
1141353691 16:83323106-83323128 GCTACACCTGTGGCAGATTTAGG + Intronic
1144586121 17:16488902-16488924 GGTGCATGTGTGGCAGTTCACGG - Intronic
1147477937 17:40731415-40731437 GTGGCACTTGAGGCAGATTAGGG - Intergenic
1150756914 17:67922955-67922977 ACTGGAATTGTGGGAGATCAGGG + Exonic
1152007764 17:77693335-77693357 GGTGGGCTTCTGGCAGATCAAGG - Intergenic
1152701534 17:81822182-81822204 GCAGCCCCTGTGGCAGAACAAGG + Intergenic
1152816313 17:82410155-82410177 CCAGCACCTGTGGCAGCTCAGGG - Intronic
1159849927 18:73515381-73515403 GCTGCACTGGCGGCTGATTAGGG - Intergenic
1160142748 18:76339855-76339877 ACAGCACTTGTGCCAGGTCATGG + Intergenic
1160371768 18:78378034-78378056 GCTGCACCTGTGGGTGCTCAGGG + Intergenic
1162935049 19:13978080-13978102 GCTGCACCTGGGGCAGAGGAAGG + Exonic
1164599747 19:29552830-29552852 ACAGCAGCTGTGGCAGATCAAGG + Intronic
1166641876 19:44500512-44500534 GCTGCTCTTGTGGCCGAACCCGG + Exonic
925233544 2:2257131-2257153 GATGCTCCTGTGGCTGATCAGGG + Intronic
928207868 2:29300009-29300031 GCTGCTCTGATGGCAGAACAAGG + Intronic
928992276 2:37246142-37246164 GCTGCACTGGTTGCTGATTATGG + Exonic
930160138 2:48146405-48146427 GGTTCACTGGTGGCAGAGCATGG - Intergenic
931544281 2:63363926-63363948 GCTGCTCTGGAGGCAGAGCAAGG + Intronic
933658620 2:84908472-84908494 GGTGAACTTGTGGAAGTTCAGGG + Intergenic
934479117 2:94618730-94618752 ACAGCAGCTGTGGCAGATCATGG - Intergenic
935203426 2:100877792-100877814 GCTGCACTTGAGCCAAATGATGG - Intronic
935935143 2:108174293-108174315 GCTGCAGTTGTGAAAGGTCATGG - Intergenic
937309369 2:120892618-120892640 GCTGCGCTGGTGGCAGTTCAGGG + Intronic
938275619 2:130018909-130018931 GCTGAACTTGTGGCAAAATAAGG - Intergenic
939364950 2:141219316-141219338 ACAGCAGCTGTGGCAGATCACGG + Intronic
940025399 2:149201405-149201427 GCAGTCTTTGTGGCAGATCAAGG - Intronic
942569982 2:177304110-177304132 GCTCCACTTGTGGTAGAAGAAGG + Intronic
944401263 2:199328799-199328821 GCTCCACTTCTGGCAGATTGAGG + Exonic
945185259 2:207133679-207133701 TCTGCACCTGTGTCAGTTCAAGG + Intronic
946615486 2:221505023-221505045 GCTGCCTTTGTGGCTGATAAAGG - Intronic
946779327 2:223176690-223176712 ACTGCACATGTGGGAGATCTAGG + Intronic
947344412 2:229175960-229175982 GTTGTACTTGAGGCAGATTATGG - Intronic
1170051489 20:12150461-12150483 GATACACATGTGGCAAATCAAGG + Intergenic
1170624539 20:18021297-18021319 GCTTCACATGAGGCAGAGCAGGG + Intronic
1170937807 20:20825000-20825022 CCTCCACGTGTGGCAGAGCAGGG - Intergenic
1172592077 20:36124964-36124986 GATGCACTCGTGCCAGATCTTGG + Intronic
1174384787 20:50180797-50180819 GCTCCACGTGTGGCACCTCACGG - Intergenic
1175465006 20:59184956-59184978 GCTGCACACGCGGCAGATGAGGG + Intergenic
1176214006 20:63939679-63939701 CTTGCACTTGTGCCAGATGAAGG - Intergenic
1176241716 20:64078600-64078622 GCTGCATTTGCTGCAGAGCAGGG + Intronic
1180785900 22:18547611-18547633 GCTGCACTTGTGGCAGATCAGGG + Intergenic
1180980189 22:19874690-19874712 GCTGCACTTGTGGGAGGGCCTGG + Intergenic
1181131186 22:20733336-20733358 GCTGCACTTGTGGCAGATCAGGG + Intronic
1181242825 22:21487165-21487187 GCTGCACTTGTGGCAGATCAGGG + Intergenic
1183170438 22:36183745-36183767 GCTGCACTTATGGGAAATGACGG - Intergenic
1184462601 22:44647794-44647816 GCTTCACATGTGCCAGTTCAGGG - Intergenic
950822470 3:15775770-15775792 GCTGAACATGTGGCAGTTCCTGG - Intronic
950863942 3:16174268-16174290 GCTGCTCTTGTGGGAGAAGAAGG + Intergenic
952694581 3:36250319-36250341 ACAGCAGCTGTGGCAGATCATGG + Intergenic
954983229 3:54765199-54765221 GCTGCACTTCTGGCAGCTACAGG + Intronic
960674841 3:120183915-120183937 GCTTTAGTTGTGACAGATCAGGG - Intronic
961179665 3:124866719-124866741 GCTGCAGGTGTGGCTGGTCAGGG - Intronic
961510198 3:127396149-127396171 GCTGCTCTTGTGGAGGATGAAGG + Intergenic
967524973 3:190481930-190481952 GCAGAACTTGTGGAAGATCCTGG - Intergenic
969163012 4:5278324-5278346 GCTGCCCAGGGGGCAGATCAAGG + Intronic
969435034 4:7184239-7184261 GCTGCTCTTCTGGCAGGTGAGGG + Intergenic
974543924 4:63275610-63275632 GCAGCACTTGTGCCACAGCAGGG - Intergenic
979542270 4:121898421-121898443 ACTGCACATGTGACAGATCTAGG + Intronic
981290679 4:143071393-143071415 ACAGCAGCTGTGGCAGATCATGG - Intergenic
982286768 4:153744055-153744077 GCTGCTCTTGTGTCAGGTCTTGG - Intronic
984591046 4:181618154-181618176 TCTGCATTTGTGACAGACCATGG + Intergenic
984609905 4:181826454-181826476 GCTCCACTTGTTACAGATCCAGG + Intergenic
988974157 5:36498820-36498842 TCTGCATTGGTGGGAGATCAAGG + Intergenic
989235287 5:39141305-39141327 GCTGCTCCTGTGGCAGAAAATGG + Intronic
991030725 5:62079680-62079702 TCTGCACTTTAGGCAGATAAGGG - Intergenic
1002467514 5:179415032-179415054 GCTGCACTGGTGGCAGCTGGAGG - Intergenic
1002827495 6:786242-786264 GCTGCCCTTGTGGCCTAACACGG - Intergenic
1003357247 6:5385375-5385397 GCTGCATTTGGGGGAGATGAAGG + Intronic
1007627718 6:43255617-43255639 GCTGCCCTGGAGGAAGATCAAGG + Exonic
1008298426 6:49805541-49805563 GCAGCTGCTGTGGCAGATCATGG + Intergenic
1014406134 6:121053345-121053367 TCTCCACTTCTGGGAGATCAGGG - Intergenic
1015868193 6:137748904-137748926 CCTGCACTTGGAGTAGATCAAGG + Intergenic
1017282861 6:152642070-152642092 GATGCACTTCTGGTAGATCCTGG - Intergenic
1018635951 6:165859594-165859616 GCTGAACATGTGGCAGCTCCTGG - Intronic
1018838984 6:167505768-167505790 GCTGCACAGGTGGCATATCAGGG - Intergenic
1020253247 7:6485798-6485820 CCGGCACTTTTGGCAGGTCAAGG + Intergenic
1022505944 7:30908699-30908721 CCTGGATTTGTGGCAGATCAGGG + Intergenic
1022518088 7:30988248-30988270 GCTGCCTTTGGGGCAGATCCAGG + Intronic
1022961442 7:35430234-35430256 TCTGCACTTGAGGCAGATGCCGG + Intergenic
1024231892 7:47369098-47369120 GCTGCTCTTGTGGCAGGTGAAGG + Exonic
1024918037 7:54525463-54525485 GCAGGGCTTTTGGCAGATCATGG - Intergenic
1028450173 7:90973321-90973343 GCTGCACATATGGCAGTGCACGG + Intronic
1029477583 7:100794157-100794179 GGTGCACCTGTGCCAGCTCACGG + Exonic
1031354258 7:120770522-120770544 GCTGAAGTTCTGGCAGATCACGG - Intergenic
1032415999 7:131736092-131736114 GCTGCATTTGTGCCAGATTTGGG - Intergenic
1034185058 7:149169511-149169533 GCTGCACTGATCTCAGATCATGG - Intronic
1036470036 8:9044835-9044857 GATGCAGGTGTGGCAGGTCAGGG - Intronic
1036608025 8:10324905-10324927 GCTGCACATGTGTGAGCTCAGGG + Intronic
1037378372 8:18257785-18257807 GGTTCACCTGTGGCAGAACATGG + Intergenic
1037832046 8:22195519-22195541 GCTGCACTTGTAGCTGCCCAGGG - Exonic
1040626986 8:49160499-49160521 GCTGCAAATGCTGCAGATCATGG - Intergenic
1046317981 8:112531576-112531598 GATGGACTTTTGGGAGATCATGG - Intronic
1047469662 8:125157817-125157839 GCTGCACTAGAGGCACATTAAGG - Intronic
1049826515 8:144672196-144672218 GCTGCATGTGTGGCTGATAAAGG - Intergenic
1050918416 9:11166654-11166676 TCAGCTCTTGTGACAGATCAGGG - Intergenic
1051370861 9:16357945-16357967 GCTGCTCTGGGGGCAGCTCAGGG + Intergenic
1053678711 9:40464835-40464857 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1053928696 9:43093188-43093210 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1054285012 9:63160107-63160129 ACAGCAGCTGTGGCAGATCATGG - Intergenic
1054291789 9:63300373-63300395 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1054389807 9:64604916-64604938 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1054505907 9:65911460-65911482 ACAGCAGCTGTGGCAGATCATGG - Intergenic
1056057490 9:82842039-82842061 GGTCCACTTGTGGCAGCTAAGGG - Intergenic
1056706468 9:88956189-88956211 ACTGCACATGTGACAGATCTAGG - Intergenic
1061041569 9:128143978-128144000 GCTTCAGTTGGGGCAGATCCAGG + Intergenic
1062090155 9:134671940-134671962 GCTGCACTTGGGCCTGACCAAGG + Intronic
1189707958 X:43778480-43778502 GCTGTGCTGGTGGCAGGTCAGGG - Intronic
1189777455 X:44483143-44483165 GTTACACTAGTGGCAAATCATGG - Intergenic
1189940149 X:46112916-46112938 ACAGCAACTGTGGCAGATCATGG - Intergenic
1191650989 X:63537417-63537439 ACTGCAGCTGTGACAGATCATGG + Intergenic
1192437073 X:71149429-71149451 GCTGCTCTGGTGGCAGAACTTGG + Intronic
1198485738 X:137085786-137085808 GGTGAATTAGTGGCAGATCATGG + Intergenic
1198634126 X:138676697-138676719 GCTGCACATGTGGAGGATCTAGG - Intronic
1198841349 X:140861069-140861091 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1199310841 X:146317934-146317956 ACAGCAGCTGTGGCAGATCATGG + Intergenic
1199791657 X:151161021-151161043 GCTGCATTTATGGGAGGTCACGG - Intergenic
1201229041 Y:11845558-11845580 GCTGCAGCGGTGGCAGGTCAGGG - Intergenic
1201730448 Y:17196927-17196949 ACTGCAATTCAGGCAGATCAAGG - Intergenic