ID: 1180785901

View in Genome Browser
Species Human (GRCh38)
Location 22:18547616-18547638
Sequence ACTTGTGGCAGATCAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 3, 1: 0, 2: 1, 3: 16, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180785894_1180785901 3 Left 1180785894 22:18547590-18547612 CCCCTACAGCTTTCCACTGAAGC 0: 3
1: 0
2: 2
3: 13
4: 132
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785898_1180785901 -10 Left 1180785898 22:18547603-18547625 CCACTGAAGCTGCACTTGTGGCA 0: 3
1: 0
2: 1
3: 21
4: 169
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785889_1180785901 25 Left 1180785889 22:18547568-18547590 CCTCCCTCACTGCCCACAGCAGC No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785895_1180785901 2 Left 1180785895 22:18547591-18547613 CCCTACAGCTTTCCACTGAAGCT 0: 3
1: 0
2: 1
3: 54
4: 514
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785888_1180785901 28 Left 1180785888 22:18547565-18547587 CCTCCTCCCTCACTGCCCACAGC No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785893_1180785901 12 Left 1180785893 22:18547581-18547603 CCACAGCAGCCCCTACAGCTTTC 0: 3
1: 0
2: 1
3: 24
4: 252
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785887_1180785901 29 Left 1180785887 22:18547564-18547586 CCCTCCTCCCTCACTGCCCACAG No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785892_1180785901 13 Left 1180785892 22:18547580-18547602 CCCACAGCAGCCCCTACAGCTTT 0: 3
1: 0
2: 1
3: 22
4: 205
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785891_1180785901 21 Left 1180785891 22:18547572-18547594 CCTCACTGCCCACAGCAGCCCCT No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785896_1180785901 1 Left 1180785896 22:18547592-18547614 CCTACAGCTTTCCACTGAAGCTG 0: 3
1: 0
2: 1
3: 14
4: 231
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1180785890_1180785901 22 Left 1180785890 22:18547571-18547593 CCCTCACTGCCCACAGCAGCCCC No data
Right 1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180785901 Original CRISPR ACTTGTGGCAGATCAGGGCA AGG Intergenic
900735081 1:4294661-4294683 ACTTGTAGCAGGGCAGGGCCAGG - Intergenic
900857565 1:5198243-5198265 AGTTGTGGAGGATCAGGGTAAGG - Intergenic
900941101 1:5799066-5799088 ACATGTGGCAGAGCTGTGCAAGG + Intergenic
901032152 1:6313442-6313464 ACTTGTGGCTGAGCAGGGTGTGG - Intronic
901462387 1:9399516-9399538 CCCTGGGGCAGAGCAGGGCAGGG - Intergenic
902195289 1:14793689-14793711 ACTTGAGACAGATCAGAACAGGG + Intronic
902195296 1:14793776-14793798 ACTTGAGACAGATCAGAACAGGG + Intronic
902953490 1:19907094-19907116 ACTTGTGGGAGTGAAGGGCAGGG - Intronic
903003420 1:20282572-20282594 ACAGGTGGCTGATCAAGGCAAGG - Intergenic
903187804 1:21639174-21639196 GCCTGGGGCAGCTCAGGGCATGG - Intronic
903215206 1:21839820-21839842 ACCTGTGGCTGAGCAGCGCAAGG + Exonic
904856206 1:33499948-33499970 CCTTGTAGCAGATTGGGGCAGGG - Intergenic
904983184 1:34523804-34523826 ACCTGTGGCAGGTCATGGCCAGG + Intergenic
905023213 1:34832082-34832104 CCATGTGGCAGATCCGGGCCTGG - Intronic
907404522 1:54245681-54245703 CCCTGTGGCTGCTCAGGGCATGG + Intronic
908482160 1:64552258-64552280 ACTTATGGAACATCAGGGCTAGG + Intronic
911014956 1:93322370-93322392 ACTTCTGGCAGGTAAGAGCATGG + Intergenic
912486844 1:110035375-110035397 ACCTGAGCCAGATCAGGCCATGG + Intronic
915677784 1:157547698-157547720 AATTGTGGCAGAGCAAGGAAGGG + Intronic
916417018 1:164601614-164601636 AATTTTGGCAGAACAGGGCATGG + Intronic
918276267 1:182956112-182956134 GCCAGTGGCAGAGCAGGGCAGGG + Intergenic
918470501 1:184868035-184868057 TCTGGTGGGAGATCAGGGCATGG - Intronic
918476734 1:184933338-184933360 ACTGGTGGCTCCTCAGGGCAGGG - Intronic
921700777 1:218266383-218266405 CCATATGGCAGAGCAGGGCATGG - Intergenic
922123105 1:222694468-222694490 AGTTGTGGCACATTAGGTCAGGG - Intronic
923099671 1:230802440-230802462 ACTTGTGGCAGATGAGGTGGAGG + Intergenic
1064155082 10:12897142-12897164 ACTGGTGGAAGAGCAGGGAAGGG + Exonic
1065723907 10:28651897-28651919 TTTTGAGGCAGATCAGGCCAAGG - Intergenic
1069827157 10:71261310-71261332 AATTGTGGCACATCTGGACAAGG - Intronic
1070618333 10:77986900-77986922 ACAGGTGGAAGATCAGAGCAGGG + Intronic
1070742021 10:78909447-78909469 TCTTGTGGCAGCTGAGGGAAGGG + Intergenic
1072460035 10:95610361-95610383 ACTGGTGACAGATCAGGGCAGGG + Intronic
1073224156 10:101902485-101902507 ACTTGTGGCACTTCTGGGCTGGG + Intronic
1075518360 10:123127954-123127976 TCTTGTTGCAGATGGGGGCAAGG + Intergenic
1075586345 10:123661013-123661035 ACATGTGGCAAACCAGGGCCTGG - Intergenic
1078062817 11:8059479-8059501 TCTTTTGGCAGGTCTGGGCAGGG + Intronic
1083822705 11:65181944-65181966 CCCGGTGGCAGCTCAGGGCAGGG - Intronic
1085457224 11:76671907-76671929 CCTTGTGGCAAATCAGGGTAAGG + Intergenic
1086423277 11:86658740-86658762 GCTTGTGGGAGATGATGGCATGG - Intronic
1089584627 11:119502533-119502555 ACTTGTGGGAGTTCAGGCCCTGG + Intergenic
1090228150 11:125083884-125083906 CCTGCTGGCAGAGCAGGGCAAGG - Intronic
1090606185 11:128424988-128425010 ACCTGTGGCAGAACATGGAAGGG + Intergenic
1096691461 12:53324740-53324762 ACTTGTGCCAGGCCAGGGCGGGG - Intronic
1096767223 12:53901549-53901571 GCTTGTGGCATCCCAGGGCATGG - Intergenic
1098994336 12:77100890-77100912 ATATGTGGCAGATGAGAGCAAGG + Intergenic
1100289288 12:93198736-93198758 ACTTGTGAAAGAACGGGGCATGG - Intergenic
1105328011 13:19387758-19387780 ACTTTTGGAATATCAGGGAAAGG - Intergenic
1106300522 13:28460151-28460173 AATTGTGTCAGATCTGGGAAGGG + Intronic
1110372705 13:74757388-74757410 AAATGTGGCATATGAGGGCAGGG + Intergenic
1120927378 14:89811151-89811173 CCTTGTGGCAGGACAGAGCAAGG + Intronic
1121950287 14:98165712-98165734 CCTTGTGGCAAATCAGCTCAAGG - Intergenic
1122095412 14:99366844-99366866 ATTTGGGGCAAATCAGGGGAAGG + Intergenic
1122390426 14:101377396-101377418 ACTTGTGGAAGAAAAGGGCAGGG - Intergenic
1122546816 14:102527699-102527721 ACATGGGGCAGGGCAGGGCAGGG + Intergenic
1122820880 14:104344197-104344219 CCAGGTGGCACATCAGGGCAGGG + Intergenic
1124220467 15:27846359-27846381 TCTTGGGGCTGAGCAGGGCAGGG - Intronic
1124378410 15:29143477-29143499 TCCTGTGGGAGGTCAGGGCATGG + Intronic
1124870641 15:33538586-33538608 TCTTCTGGCTGTTCAGGGCAGGG + Intronic
1125733743 15:41909312-41909334 GCGTGAGGCAGGTCAGGGCAGGG + Intronic
1126818977 15:52482761-52482783 AGTTGCGGCAGCTCAAGGCAAGG + Intronic
1127379567 15:58419351-58419373 GCTTCTGGCAGGGCAGGGCAGGG - Intronic
1127935890 15:63637552-63637574 AGTTATGGCAGATTAGGACAAGG - Exonic
1128978177 15:72168159-72168181 CCTTGGGGCAGAGCAGAGCAGGG - Intronic
1129963283 15:79709597-79709619 ACCTGGGTCAGCTCAGGGCAGGG + Intergenic
1131402059 15:92133140-92133162 ACTTGTGGCTGGGGAGGGCAGGG - Intronic
1132373008 15:101310855-101310877 GCTTGTGTCAGAGCAGGGGAGGG - Intronic
1139957686 16:70700914-70700936 ACCTGTGGCAGCAGAGGGCAGGG + Intronic
1143776993 17:9206060-9206082 ACTGGTGGCAGAGCAGGGTCTGG + Intronic
1143885642 17:10062934-10062956 ACTTGGGGCAGCCCAGGGGAAGG + Intronic
1146954830 17:36931471-36931493 AGTGGTGGGAGGTCAGGGCAAGG - Intergenic
1147381734 17:40060330-40060352 ACTGGTGACAGGTCTGGGCAGGG - Intronic
1148738952 17:49881083-49881105 ATTTGGGGCAGTTCAGGGCAAGG + Intergenic
1149311145 17:55395395-55395417 ACCTAAGGCAGATCACGGCAGGG + Intronic
1156857889 18:41803879-41803901 ACTTAGGGCAGAACAGGGGATGG - Intergenic
1157698770 18:49746080-49746102 ACCTGTGGCTGAGCAGGACAGGG + Intergenic
1157839650 18:50944767-50944789 ACTTGTGGCAGAGCATGGGAGGG - Intronic
1160300257 18:77671765-77671787 ACTTGTGGAAGATGTGGTCATGG + Intergenic
1161397309 19:4051701-4051723 CCCTGTGCCAGATCTGGGCAAGG - Intronic
1161607331 19:5222378-5222400 ACTTGGGACAGGACAGGGCAGGG - Intronic
1162392045 19:10395696-10395718 CCTTGGGGCAGATCAGAGGAGGG + Intronic
1164879627 19:31721028-31721050 ACTTGGGGCTGATAAGTGCAAGG - Intergenic
1166587259 19:43960625-43960647 TCTTGAGGCTGCTCAGGGCAGGG - Intronic
930160135 2:48146400-48146422 ACTGGTGGCAGAGCATGGGAGGG - Intergenic
930403013 2:50914905-50914927 CCTTGAGACACATCAGGGCAGGG + Intronic
931318190 2:61151931-61151953 ATCTGTGGCAAACCAGGGCAGGG - Intronic
937051297 2:118893288-118893310 AGTTGTGGCAGAGGTGGGCATGG - Intergenic
937066452 2:119021426-119021448 AGTTGTTGCACATTAGGGCAAGG + Intergenic
937381764 2:121383657-121383679 ACATATGGCAGACCAGAGCAAGG + Intronic
937908831 2:127065553-127065575 ACTGTTGGCAGTTGAGGGCAGGG - Intronic
938279037 2:130051773-130051795 ACTTGTGGCAGATTGGGACAGGG - Intergenic
938330020 2:130442649-130442671 ACTTGTGGCAGATTGGGACAGGG - Intergenic
938359925 2:130678854-130678876 ACTTGTGGCAGATTGGGACAGGG + Intergenic
938436333 2:131285575-131285597 ACTTGTGGCAGATTGGGACAGGG + Intronic
939521854 2:143241495-143241517 AGTAGTGGCAGATGAGGGAAGGG + Intronic
940368746 2:152877409-152877431 ATCTGTGGCACATCAGGCCAGGG - Intergenic
942350603 2:175049251-175049273 AATTGTGGCAGCTTAGGTCATGG + Intergenic
945912894 2:215669623-215669645 ACTTGGGTAAGAGCAGGGCAGGG - Intergenic
946526107 2:220521947-220521969 AAGTATGGCAGATCTGGGCAGGG + Intergenic
947228581 2:227863222-227863244 ACTTTGGGCAGATTAGGGAAAGG - Intergenic
947524617 2:230870580-230870602 AGGTGTGGCAGAGAAGGGCAGGG - Intronic
1169019690 20:2320205-2320227 ACTTTAGGCAAATCTGGGCACGG - Intronic
1176214004 20:63939674-63939696 ACTTGTGCCAGATGAAGGAAGGG - Intergenic
1178600087 21:33987402-33987424 GCTCATGGCACATCAGGGCAGGG + Intergenic
1179370371 21:40801194-40801216 CCTTGTGTCAGACCAAGGCAGGG - Intronic
1180785901 22:18547616-18547638 ACTTGTGGCAGATCAGGGCAAGG + Intergenic
1181131187 22:20733341-20733363 ACTTGTGGCAGATCAGGGCAAGG + Intronic
1181242826 22:21487170-21487192 ACTTGTGGCAGATCAGGGCAAGG + Intergenic
1181317166 22:21978271-21978293 ACCTGAGGCAGAGCTGGGCATGG + Intronic
1182017449 22:27052595-27052617 ACTTGTGAGATATGAGGGCAGGG + Intergenic
1183488828 22:38106025-38106047 ACTTGTGGCACACCTGGGCTGGG - Intronic
1185060392 22:48603470-48603492 GCTGGTGGAAGATTAGGGCAGGG + Intronic
950857412 3:16118861-16118883 AATTGTGGGAGAAAAGGGCAAGG - Intergenic
955829892 3:62989992-62990014 AATAGTGGAAGATCATGGCAGGG - Intergenic
955869457 3:63421815-63421837 CCCTGTGGCAGAGAAGGGCAGGG - Intronic
956571875 3:70705655-70705677 ACTTTTGGGAGATTAGGCCATGG - Intergenic
956810316 3:72858156-72858178 AGTTGTCTCATATCAGGGCAAGG - Intronic
959306561 3:104674271-104674293 GCTTGTGGAAGACCAGGACAGGG - Intergenic
960672051 3:120163829-120163851 GTTTGTGGCAGACCAGGACAGGG + Intergenic
961736516 3:129005166-129005188 ACAGGTGGCTGCTCAGGGCAGGG - Intronic
961832856 3:129633135-129633157 ACTTGTGGCGGGGCAGGGCTGGG + Intergenic
962087202 3:132204215-132204237 ACCTCTGGCAGAGCAGGACAAGG + Intronic
964314997 3:155434327-155434349 ACTTATGCCAGGACAGGGCAGGG - Intronic
966268895 3:178081437-178081459 AATGGTGGGAGATCAGGGCACGG - Intergenic
972345987 4:38192689-38192711 ACTTTGGGCAGGTCCGGGCAGGG + Intergenic
974086222 4:57264074-57264096 AGTTGTGGCAGGTGAGGGTAAGG + Intergenic
977509012 4:97938159-97938181 AGCTGTGGCAGATCATGGCCAGG - Intronic
978413132 4:108446850-108446872 ACCTGTGGCTGAGGAGGGCAAGG + Intergenic
981277432 4:142917657-142917679 ATTTGTGGCAAATCAGGACCAGG + Intergenic
985530492 5:431130-431152 CCTGGTGTCAGAGCAGGGCAGGG + Intronic
985779573 5:1863140-1863162 ACTTAAGCCAGATCAGGGCCCGG - Intergenic
990953490 5:61321154-61321176 AATGGTGGCAGATCAGAGTAGGG - Intergenic
992979374 5:82152198-82152220 ACTTGGTGCAGATTAGGACAGGG + Intronic
994986845 5:106945175-106945197 ACTTGTGGCAGGACAGAACATGG + Intergenic
995446121 5:112246066-112246088 ACTGGTGGCAGAGCTGGGAAAGG + Intronic
997635287 5:135399711-135399733 TCTTGGGGCAGACCAGGGCTTGG - Intronic
999783294 5:154868738-154868760 ACTTCTGGCAGAACAAGGCTTGG - Intronic
1002607308 5:180390812-180390834 CCTTGTGCAGGATCAGGGCACGG + Intergenic
1003047113 6:2744081-2744103 GCTGGTGCTAGATCAGGGCAGGG - Intronic
1003080278 6:3015989-3016011 ACTTGTGCCAGGCCAGGGCTGGG - Intronic
1004033030 6:11891137-11891159 ACTTGTAGAAAATCATGGCAAGG - Intergenic
1005310524 6:24554761-24554783 ACTGGTAGCAGAGCAGAGCAAGG + Intronic
1006150360 6:31983735-31983757 ACTGGGAGCAGCTCAGGGCAGGG + Intronic
1006156661 6:32016473-32016495 ACTGGGAGCAGCTCAGGGCAGGG + Intronic
1015368769 6:132426716-132426738 ACTTGTAGCATGTCAGAGCAAGG - Intergenic
1015634520 6:135262630-135262652 GCATGTGGGAGATCAGGGAATGG - Intergenic
1017287000 6:152686935-152686957 ATTTGTGGCAGATCAGTGTATGG + Intergenic
1018845104 6:167550583-167550605 ACTTGTGCCCGTGCAGGGCATGG - Intergenic
1019063093 6:169271275-169271297 ACTTTTGTCAGCTCAGTGCAGGG - Intergenic
1022117519 7:27275337-27275359 ACATGTGGCAAATCAGGAAAAGG - Intergenic
1025053749 7:55747827-55747849 ACTTGAGGAAGTTCAGGGCCTGG + Intergenic
1025131854 7:56378301-56378323 ACTTGAGGAAGTTCAGGGCCTGG + Intergenic
1025943968 7:66092494-66092516 AATGGAGGCAGATCAGGGCATGG + Intronic
1028253855 7:88567755-88567777 ACTTGTGGCAGATGTAGCCAAGG + Intergenic
1028297105 7:89147569-89147591 ACTGGTAGCAGCCCAGGGCATGG - Intronic
1029166089 7:98592116-98592138 GACTGTGGCAGCTCAGGGCAAGG + Intergenic
1034837930 7:154369766-154369788 ACATGTGGCAGCTCAGAGCTGGG - Intronic
1035709787 8:1704144-1704166 ACTTCTAGCAGATCATGCCATGG + Exonic
1036200151 8:6764075-6764097 ACCAGTGGCAGGGCAGGGCAGGG - Intergenic
1038182677 8:25243772-25243794 CCTTCTGCCAGATGAGGGCAAGG + Intronic
1039846570 8:41329874-41329896 CCTTGTGGCTGTTTAGGGCAAGG - Intergenic
1040880714 8:52201477-52201499 ACTCCTGCCAAATCAGGGCAGGG - Intronic
1041729231 8:61048257-61048279 ATGTGTGGCAGAGCAGGGCATGG + Intergenic
1042939507 8:74092904-74092926 AATTGTGGCAGTTCAGAGGATGG - Intergenic
1044954775 8:97468594-97468616 ATTTGAGGCAGATGAGTGCATGG + Intergenic
1045141995 8:99296253-99296275 TTCTGTGCCAGATCAGGGCAAGG + Intronic
1046773958 8:118144188-118144210 AATTGTGGCTTATCTGGGCAGGG - Intergenic
1052022643 9:23542627-23542649 ACTTGAAGCTGATCAGGGAAGGG - Intergenic
1052803793 9:32994337-32994359 ACTTGAGATGGATCAGGGCAGGG - Intronic
1056030268 9:82546128-82546150 AGTCATTGCAGATCAGGGCAAGG + Intergenic
1057862062 9:98648555-98648577 ACCTGTGGCAGAGCAGGGCCTGG - Intronic
1058800939 9:108543830-108543852 ACCTATGGCAGTTCAGGGCTTGG - Intergenic
1061579850 9:131530215-131530237 AGTTGTGGCAGGGCAGGGCAGGG + Intronic
1061789900 9:133053688-133053710 GCATGTGGCAGAGCAGGGCTGGG + Intronic
1061923648 9:133795523-133795545 AGTTGGGGCAGGGCAGGGCAGGG - Intronic
1062459640 9:136657518-136657540 CCTCGTGTCAGACCAGGGCATGG - Intergenic
1188429599 X:30091403-30091425 CCTTGTGGAAGATCAGGAGAAGG + Intergenic
1190329492 X:49226849-49226871 AGTTGTTGCAGATCAGGCCTGGG + Intronic
1192504322 X:71671710-71671732 TCCTGTGGCAGGGCAGGGCAGGG - Intergenic
1197288633 X:124627181-124627203 ACTTAAGGCACATGAGGGCAGGG - Intronic
1200163905 X:154023035-154023057 GCTTCTGGCTGATCTGGGCAGGG + Intronic