ID: 1180791511

View in Genome Browser
Species Human (GRCh38)
Location 22:18577764-18577786
Sequence GCCCCTCACCTCGTGTGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180791504_1180791511 -8 Left 1180791504 22:18577749-18577771 CCGCCCCCCAAGGCCGCCCCTCA No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791495_1180791511 9 Left 1180791495 22:18577732-18577754 CCCGCTCCCCGCGACCCCCGCCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791492_1180791511 14 Left 1180791492 22:18577727-18577749 CCCCGCCCGCTCCCCGCGACCCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791491_1180791511 15 Left 1180791491 22:18577726-18577748 CCCCCGCCCGCTCCCCGCGACCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791503_1180791511 -7 Left 1180791503 22:18577748-18577770 CCCGCCCCCCAAGGCCGCCCCTC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791496_1180791511 8 Left 1180791496 22:18577733-18577755 CCGCTCCCCGCGACCCCCGCCCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791493_1180791511 13 Left 1180791493 22:18577728-18577750 CCCGCCCGCTCCCCGCGACCCCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791501_1180791511 -5 Left 1180791501 22:18577746-18577768 CCCCCGCCCCCCAAGGCCGCCCC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791490_1180791511 19 Left 1180791490 22:18577722-18577744 CCGGCCCCCGCCCGCTCCCCGCG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791486_1180791511 28 Left 1180791486 22:18577713-18577735 CCCGCGGCCCCGGCCCCCGCCCG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791487_1180791511 27 Left 1180791487 22:18577714-18577736 CCGCGGCCCCGGCCCCCGCCCGC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791497_1180791511 3 Left 1180791497 22:18577738-18577760 CCCCGCGACCCCCGCCCCCCAAG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791489_1180791511 20 Left 1180791489 22:18577721-18577743 CCCGGCCCCCGCCCGCTCCCCGC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791502_1180791511 -6 Left 1180791502 22:18577747-18577769 CCCCGCCCCCCAAGGCCGCCCCT No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791500_1180791511 1 Left 1180791500 22:18577740-18577762 CCGCGACCCCCGCCCCCCAAGGC No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791494_1180791511 12 Left 1180791494 22:18577729-18577751 CCGCCCGCTCCCCGCGACCCCCG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791498_1180791511 2 Left 1180791498 22:18577739-18577761 CCCGCGACCCCCGCCCCCCAAGG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data
1180791488_1180791511 21 Left 1180791488 22:18577720-18577742 CCCCGGCCCCCGCCCGCTCCCCG No data
Right 1180791511 22:18577764-18577786 GCCCCTCACCTCGTGTGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180791511 Original CRISPR GCCCCTCACCTCGTGTGCGT CGG Intergenic