ID: 1180793433

View in Genome Browser
Species Human (GRCh38)
Location 22:18589999-18590021
Sequence GTCTCCACCATTAGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180793427_1180793433 30 Left 1180793427 22:18589946-18589968 CCTGGGTCTCCTGCTCCTGATCA No data
Right 1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG No data
1180793428_1180793433 21 Left 1180793428 22:18589955-18589977 CCTGCTCCTGATCAATCTGCCAC No data
Right 1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG No data
1180793431_1180793433 -5 Left 1180793431 22:18589981-18590003 CCATTTGATCTCAGAGTTGTCTC No data
Right 1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG No data
1180793430_1180793433 2 Left 1180793430 22:18589974-18589996 CCACGTGCCATTTGATCTCAGAG No data
Right 1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG No data
1180793429_1180793433 15 Left 1180793429 22:18589961-18589983 CCTGATCAATCTGCCACGTGCCA No data
Right 1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180793433 Original CRISPR GTCTCCACCATTAGACTGGC AGG Intergenic
No off target data available for this crispr