ID: 1180795199

View in Genome Browser
Species Human (GRCh38)
Location 22:18600357-18600379
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180795199_1180795204 -8 Left 1180795199 22:18600357-18600379 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1180795204 22:18600372-18600394 TTCCAAAGTGCTGGAACTACAGG No data
1180795199_1180795206 10 Left 1180795199 22:18600357-18600379 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1180795206 22:18600390-18600412 ACAGGCTTGTGCCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180795199 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr