ID: 1180795890

View in Genome Browser
Species Human (GRCh38)
Location 22:18605143-18605165
Sequence TTCCCCGAGGGCATCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180795890_1180795894 -8 Left 1180795890 22:18605143-18605165 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1180795894 22:18605158-18605180 TCGGGGAAGATGTGGCCCAGAGG No data
1180795890_1180795896 3 Left 1180795890 22:18605143-18605165 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1180795896 22:18605169-18605191 GTGGCCCAGAGGAGTTTTTTGGG No data
1180795890_1180795895 2 Left 1180795890 22:18605143-18605165 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1180795895 22:18605168-18605190 TGTGGCCCAGAGGAGTTTTTTGG No data
1180795890_1180795899 22 Left 1180795890 22:18605143-18605165 CCTGCGGGGATGCCCTCGGGGAA No data
Right 1180795899 22:18605188-18605210 TGGGCCTTGCTCCTCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180795890 Original CRISPR TTCCCCGAGGGCATCCCCGC AGG (reversed) Intergenic
No off target data available for this crispr