ID: 1180796875

View in Genome Browser
Species Human (GRCh38)
Location 22:18610234-18610256
Sequence GCTGCTTGTTCTCCGCTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 2, 2: 0, 3: 7, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180796866_1180796875 24 Left 1180796866 22:18610187-18610209 CCGCTTCACCTTCTCGTCTGCCT 0: 3
1: 0
2: 3
3: 56
4: 588
Right 1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG 0: 1
1: 2
2: 0
3: 7
4: 124
1180796870_1180796875 16 Left 1180796870 22:18610195-18610217 CCTTCTCGTCTGCCTGGTAGGGG 0: 3
1: 0
2: 0
3: 11
4: 133
Right 1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG 0: 1
1: 2
2: 0
3: 7
4: 124
1180796872_1180796875 4 Left 1180796872 22:18610207-18610229 CCTGGTAGGGGCAGCCTGCACGC 0: 3
1: 0
2: 0
3: 13
4: 118
Right 1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG 0: 1
1: 2
2: 0
3: 7
4: 124
1180796873_1180796875 -10 Left 1180796873 22:18610221-18610243 CCTGCACGCCGCAGCTGCTTGTT 0: 3
1: 0
2: 0
3: 10
4: 105
Right 1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG 0: 1
1: 2
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180796875 Original CRISPR GCTGCTTGTTCTCCGCTTGC AGG Exonic
900364852 1:2307009-2307031 CCTGCTGGTCCTCTGCTTGCTGG + Exonic
901689814 1:10965390-10965412 GCGGCTGGTTGTCCCCTTGCAGG + Intronic
901881942 1:12199241-12199263 GCTGCTTCTCCTCCCCTTCCAGG + Intronic
902462844 1:16591922-16591944 GCTGTTTGTTCTCTGCCAGCTGG + Exonic
903158678 1:21468800-21468822 GCTGTTTGTTCTCTGCCAGCTGG - Exonic
904328346 1:29741996-29742018 TCTGCATGTTCTCTGCTTACTGG + Intergenic
906402483 1:45515184-45515206 GCTGCTTCTTCTCTGCTGCCAGG + Intronic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
909831044 1:80190431-80190453 GGTGTTTGTTCTCTGCTTACAGG + Intergenic
910631947 1:89364431-89364453 GCTCCTTGTTCTCTGCATTCTGG - Intronic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
913990956 1:143611314-143611336 GCTGTTTGTTCTCTGCCAGCTGG + Intergenic
914049466 1:144119508-144119530 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
914129718 1:144845932-144845954 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
914212283 1:145590961-145590983 GCTGTTTGTTCTCTGCCAGCTGG + Intergenic
914940501 1:152018741-152018763 GCTGTTTGTTCTCTGCCGGCTGG - Intergenic
915431142 1:155868053-155868075 TCTGCTTCTTCTCTGCCTGCTGG - Exonic
917624187 1:176829445-176829467 CCTGCCTGTTCACCGCATGCAGG - Intronic
920582633 1:207125955-207125977 GCGGCTTGTTTTCTGCTTGTCGG + Intronic
1063365244 10:5486634-5486656 GCTGCCTCTCCTCCGCCTGCAGG - Intergenic
1063989967 10:11550405-11550427 GCTGCTTGTTTTCTTCTTACTGG - Intronic
1064000642 10:11661330-11661352 GCTGCTTCTGCTCTGCTTCCTGG - Intergenic
1068691638 10:59921819-59921841 GCAGCTTGCTCTCAGCTTGTAGG + Intergenic
1071439736 10:85679722-85679744 GTTGCTTCTTCTCAGCTAGCAGG - Intronic
1072196240 10:93119266-93119288 TCTGCTTGTTCACCTCCTGCTGG + Intergenic
1072386043 10:94929229-94929251 GCAGCTTATTCACAGCTTGCAGG - Intergenic
1073473763 10:103739783-103739805 ACAGCTTCTTCTCCGCTTTCAGG - Intronic
1075780206 10:125012482-125012504 ACTGCTTGTTCTCTTCCTGCCGG + Intronic
1076254062 10:129006092-129006114 GCTGCTAGCTCTCCTCTTCCAGG - Intergenic
1083681379 11:64353374-64353396 GCTGCCGGTTCTCCTCTTCCTGG - Exonic
1084643199 11:70438053-70438075 GCAGCTTGCTCTCAGCCTGCTGG + Intergenic
1085390549 11:76179960-76179982 GCTCCTGGTTCTGCCCTTGCTGG - Intergenic
1088104532 11:106191322-106191344 GCTGCTTATTCTTCGTTTTCAGG + Intergenic
1091767368 12:3130379-3130401 GCTACTAGCTTTCCGCTTGCTGG + Intronic
1104685311 12:130780956-130780978 GCTGCTTGTACCACCCTTGCTGG - Intergenic
1110744222 13:79033876-79033898 GCTGCTGACTCTCAGCTTGCAGG - Intergenic
1113890517 13:113732877-113732899 GCTCCTTGTTCTCCACCTGTGGG - Exonic
1114468221 14:22939988-22940010 TCTGCTTGTTTTCAGCCTGCTGG + Intergenic
1118276365 14:64389084-64389106 TCTGCCTGTTCTACCCTTGCGGG + Intronic
1122083198 14:99281161-99281183 GCTGCCTGTTATTGGCTTGCAGG - Intergenic
1122774266 14:104110293-104110315 GCTGCTAGTCCTCCTCCTGCTGG - Intronic
1123419342 15:20118744-20118766 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1123448367 15:20345357-20345379 GGTGCTTGCTCTCCGATTCCTGG + Intergenic
1123528564 15:21125286-21125308 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1123926603 15:25118825-25118847 GCTGCTTTTTCTCCTTTTGCTGG - Intergenic
1125439182 15:39683166-39683188 CCTACTTGTTCTCTGCTGGCTGG + Intronic
1127401945 15:58597227-58597249 GCTGCATTTTCTTCACTTGCAGG - Exonic
1127674780 15:61228846-61228868 GCAGCCCGTTCTCGGCTTGCGGG - Intronic
1128627479 15:69224658-69224680 GCAGTTTGTACTCAGCTTGCAGG - Intronic
1131624051 15:94099324-94099346 GCTGCAAGTTCTCCTCTAGCAGG - Intergenic
1131680942 15:94722532-94722554 GCTACAGGTTCTCAGCTTGCAGG - Intergenic
1135007334 16:18838079-18838101 TCTGCTTGCTCTCGGCCTGCTGG + Exonic
1137571208 16:49567550-49567572 GCCGCTTGTTGTCCGATTCCTGG - Intronic
1141661752 16:85445206-85445228 GCTGCTTGCTCTCCTCTCCCGGG + Intergenic
1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG + Intergenic
1142685669 17:1575732-1575754 GCTGCTCCTTCTCAGCCTGCTGG - Exonic
1148262095 17:46193048-46193070 GCTGCTTTTTCTTCTCTTTCGGG + Intronic
1150656034 17:67040467-67040489 GCTGCCTGCTCTCCTCCTGCAGG + Intergenic
1203163348 17_GL000205v2_random:71709-71731 GCTGCTTGTACTCTGATTTCAGG - Intergenic
1152997496 18:421458-421480 GTTGCTTGTTTTCTGCTTGTAGG + Intronic
1161683506 19:5692157-5692179 CCTTCTTGTTCTCGGCTGGCAGG + Exonic
1164082932 19:21876156-21876178 GCTGCTTGTGCCCTGCTTTCAGG + Intergenic
1164180652 19:22815447-22815469 GCTGCCTGTGCTCTGCTTTCAGG + Intergenic
1164190915 19:22916275-22916297 GCTGCTTGTGCCCTGCTTTCAGG + Intergenic
1164703472 19:30302796-30302818 ACTGATTGCTCTCTGCTTGCAGG - Intronic
1167736225 19:51296075-51296097 GCTGCTTGCTCTGCCCTTGCTGG - Intergenic
1168078476 19:53992898-53992920 GCCGCCGGTTCTCCTCTTGCAGG - Exonic
1202678506 1_KI270711v1_random:29354-29376 GCTGTTTGTTCTCTGCCAGCTGG + Intergenic
1202688854 1_KI270712v1_random:72076-72098 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
926314344 2:11698196-11698218 GCTGTCTGTTCTCCCCTGGCCGG + Intronic
930066657 2:47332747-47332769 GCTGCCTGTTCCCCGCTTCCTGG - Intergenic
933957581 2:87384023-87384045 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
934241701 2:90275918-90275940 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
934271472 2:91540767-91540789 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
934516478 2:94991180-94991202 GCTGTTTGTTATCCACTTGGTGG - Intergenic
937362510 2:121238911-121238933 GCTGCCTGTTTTCTGCTTGCAGG - Intronic
938777905 2:134558258-134558280 TCTGCTCGTGCTCCACTTGCTGG - Intronic
944211499 2:197211006-197211028 GCTGCCTTTTCTCGGCATGCAGG - Intronic
946229240 2:218281601-218281623 GCAGCTTGTTGGCCGCTTGTTGG + Intronic
948677582 2:239607850-239607872 GTTGCTGGTTCTCAGCCTGCTGG + Intergenic
1169213045 20:3778217-3778239 GCTGCTTACGCTCCGCCTGCTGG + Exonic
1171935858 20:31274394-31274416 GCTCCTCGTTCTCCTCTTGTTGG - Intergenic
1172239000 20:33399525-33399547 GATACTTGTTCCCTGCTTGCAGG - Intronic
1176338131 21:5618110-5618132 GCTGCTTGTACTCTGATTTCAGG + Intergenic
1176339539 21:5681183-5681205 GCTGCTTGTACTCTGATTTCAGG + Intergenic
1176471793 21:7113336-7113358 GCTGCTTGTACTCTGATTTCAGG + Intergenic
1176495354 21:7495114-7495136 GCTGCTTGTACTCTGATTTCAGG + Intergenic
1176505288 21:7643273-7643295 GCTGCTTGTACTCTGATTTCAGG - Intergenic
1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG + Exonic
1181224849 22:21385037-21385059 GCTGCTTGTTCTCCTCTTGCAGG - Exonic
1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG + Exonic
1181351464 22:22261511-22261533 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1183187607 22:36300868-36300890 TCTTCTTCTTCTCCGCCTGCAGG + Exonic
1183857463 22:40645106-40645128 GCTGATTGTTCCCCTCTTGTGGG - Intergenic
1184604198 22:45562843-45562865 TCTGCCGTTTCTCCGCTTGCTGG + Intronic
953468177 3:43142889-43142911 GGTGCTTTTTCTCAGATTGCAGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955698099 3:61656748-61656770 GCTTCTTGTTCTTTGCTTTCTGG + Intronic
961542968 3:127612685-127612707 GGTGCTTTTTCTCCGTTTGCTGG + Intronic
965337893 3:167450317-167450339 GCTCCTTTTTCTCCCCTTGGTGG + Intronic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
967489455 3:190073431-190073453 TCTGCTTGTTTTCAGCTTCCGGG + Intronic
973669234 4:53198311-53198333 GTTGCTTGTTTTCTGCCTGCTGG + Intronic
975663075 4:76706788-76706810 GCTGCTAGTTGCCTGCTTGCTGG - Intronic
985394847 4:189531281-189531303 AGTTCTTGTTCTCCACTTGCAGG + Intergenic
986595978 5:9422407-9422429 GATGCTTCTTCTCCGGATGCTGG - Intronic
1002584194 5:180231493-180231515 GCTGCCTTTTCTACCCTTGCTGG - Intergenic
1011345170 6:86361404-86361426 GCTGCTTGTTCTCAGTTTCCTGG - Intergenic
1012149983 6:95736427-95736449 GCAGCTTGTGCACAGCTTGCAGG + Intergenic
1012343487 6:98157064-98157086 GCCGGTTGTTCTTGGCTTGCTGG + Intergenic
1012912792 6:105136808-105136830 GCTGCTTGTTCTACGCGCCCGGG - Intronic
1017881373 6:158564933-158564955 GCTGCTTGTTCAACTCATGCCGG - Intronic
1020108382 7:5433598-5433620 CCTGTTTTTTCTCCGCTTCCCGG - Intronic
1022923324 7:35037367-35037389 GGTGCTTGTTCCGCGCCTGCAGG + Intronic
1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG + Intronic
1029513589 7:101012228-101012250 GGTGCTTGGGCTCCACTTGCTGG + Intronic
1035589596 8:802479-802501 GCTGCTGCTTCTCAACTTGCTGG + Intergenic
1036132853 8:6132506-6132528 GCTGCTTGTTTTCCACTTAAAGG - Intergenic
1038538015 8:28368527-28368549 GCTGCTGGGTCTCCACTTGTGGG - Intronic
1040444115 8:47476425-47476447 GCTGCTTATTGGCCGCATGCTGG - Intronic
1044079085 8:87861758-87861780 TCTGCCTGTTCTCAGCCTGCTGG + Intergenic
1045018167 8:98017351-98017373 GCTGCTTGTCCTGGGCTGGCTGG - Intronic
1049689404 8:143952105-143952127 GCTGCTTGTTGGCCGCCTGCCGG - Intronic
1053044658 9:34905287-34905309 GGTGCTTGTTCTCCTCTGGTAGG - Intergenic
1057753421 9:97810317-97810339 GGTGTTTGTCCTCTGCTTGCTGG + Intergenic
1061430351 9:130526871-130526893 GCTGCATGTTCTGTCCTTGCGGG - Intergenic
1062053424 9:134458659-134458681 GCTGCTGGCTCTCTGCTTACCGG + Intergenic
1203423534 Un_GL000195v1:16808-16830 GCTGCTTGTACTCTGATTTCAGG - Intergenic
1188485794 X:30680570-30680592 TCTGGTTGTTCTCCGCATACTGG - Intronic
1189717572 X:43881966-43881988 GCTGCTAGGCCTTCGCTTGCTGG - Intronic
1195844249 X:109209202-109209224 GCTGGTGGTTCTTAGCTTGCTGG + Intergenic
1196032604 X:111107470-111107492 GCTTCTTTTTATCCACTTGCAGG - Intronic
1197027836 X:121776367-121776389 GCTGCTTGTTATCAGTGTGCAGG + Intergenic
1200858535 Y:7965235-7965257 CCTGCTTGCTCTCTGCTTACAGG - Intergenic