ID: 1180799784

View in Genome Browser
Species Human (GRCh38)
Location 22:18626355-18626377
Sequence CACCTTGAGAAGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180799784_1180799790 8 Left 1180799784 22:18626355-18626377 CCCAGCTGCAGCTTCTCAAGGTG No data
Right 1180799790 22:18626386-18626408 GGACCCTTGCCACACTTGCAGGG No data
1180799784_1180799796 28 Left 1180799784 22:18626355-18626377 CCCAGCTGCAGCTTCTCAAGGTG No data
Right 1180799796 22:18626406-18626428 GGGAGTCAGAGCTGGCCCCAGGG No data
1180799784_1180799795 27 Left 1180799784 22:18626355-18626377 CCCAGCTGCAGCTTCTCAAGGTG No data
Right 1180799795 22:18626405-18626427 AGGGAGTCAGAGCTGGCCCCAGG No data
1180799784_1180799789 7 Left 1180799784 22:18626355-18626377 CCCAGCTGCAGCTTCTCAAGGTG No data
Right 1180799789 22:18626385-18626407 GGGACCCTTGCCACACTTGCAGG No data
1180799784_1180799794 20 Left 1180799784 22:18626355-18626377 CCCAGCTGCAGCTTCTCAAGGTG No data
Right 1180799794 22:18626398-18626420 CACTTGCAGGGAGTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180799784 Original CRISPR CACCTTGAGAAGCTGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr