ID: 1180800005

View in Genome Browser
Species Human (GRCh38)
Location 22:18627308-18627330
Sequence CTGGCCCCTGGGACCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800005_1180800024 24 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800024 22:18627355-18627377 GGAAGAGAGTTGTGAAGGGTGGG No data
1180800005_1180800022 20 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800022 22:18627351-18627373 GAGGGGAAGAGAGTTGTGAAGGG No data
1180800005_1180800011 -9 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800011 22:18627322-18627344 AGGGGCCAGGAGGGCCCCTGTGG No data
1180800005_1180800014 -2 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800014 22:18627329-18627351 AGGAGGGCCCCTGTGGTGCTGGG No data
1180800005_1180800023 23 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800023 22:18627354-18627376 GGGAAGAGAGTTGTGAAGGGTGG No data
1180800005_1180800016 2 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800016 22:18627333-18627355 GGGCCCCTGTGGTGCTGGGAGGG No data
1180800005_1180800026 30 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800026 22:18627361-18627383 GAGTTGTGAAGGGTGGGTTTGGG No data
1180800005_1180800017 3 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800017 22:18627334-18627356 GGCCCCTGTGGTGCTGGGAGGGG No data
1180800005_1180800021 19 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800021 22:18627350-18627372 GGAGGGGAAGAGAGTTGTGAAGG No data
1180800005_1180800015 1 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800015 22:18627332-18627354 AGGGCCCCTGTGGTGCTGGGAGG No data
1180800005_1180800013 -3 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800013 22:18627328-18627350 CAGGAGGGCCCCTGTGGTGCTGG No data
1180800005_1180800025 29 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800005 Original CRISPR CTGGCCCCTGGGACCTCCCA TGG (reversed) Intergenic
No off target data available for this crispr