ID: 1180800009

View in Genome Browser
Species Human (GRCh38)
Location 22:18627319-18627341
Sequence CAGGGGCCCTCCTGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800009_1180800023 12 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800023 22:18627354-18627376 GGGAAGAGAGTTGTGAAGGGTGG No data
1180800009_1180800026 19 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800026 22:18627361-18627383 GAGTTGTGAAGGGTGGGTTTGGG No data
1180800009_1180800022 9 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800022 22:18627351-18627373 GAGGGGAAGAGAGTTGTGAAGGG No data
1180800009_1180800017 -8 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800017 22:18627334-18627356 GGCCCCTGTGGTGCTGGGAGGGG No data
1180800009_1180800016 -9 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800016 22:18627333-18627355 GGGCCCCTGTGGTGCTGGGAGGG No data
1180800009_1180800025 18 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800009_1180800015 -10 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800015 22:18627332-18627354 AGGGCCCCTGTGGTGCTGGGAGG No data
1180800009_1180800024 13 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800024 22:18627355-18627377 GGAAGAGAGTTGTGAAGGGTGGG No data
1180800009_1180800021 8 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800021 22:18627350-18627372 GGAGGGGAAGAGAGTTGTGAAGG No data
1180800009_1180800027 26 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800027 22:18627368-18627390 GAAGGGTGGGTTTGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800009 Original CRISPR CAGGGGCCCTCCTGGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr