ID: 1180800010

View in Genome Browser
Species Human (GRCh38)
Location 22:18627320-18627342
Sequence ACAGGGGCCCTCCTGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800010_1180800026 18 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800026 22:18627361-18627383 GAGTTGTGAAGGGTGGGTTTGGG No data
1180800010_1180800017 -9 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800017 22:18627334-18627356 GGCCCCTGTGGTGCTGGGAGGGG No data
1180800010_1180800024 12 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800024 22:18627355-18627377 GGAAGAGAGTTGTGAAGGGTGGG No data
1180800010_1180800022 8 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800022 22:18627351-18627373 GAGGGGAAGAGAGTTGTGAAGGG No data
1180800010_1180800016 -10 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800016 22:18627333-18627355 GGGCCCCTGTGGTGCTGGGAGGG No data
1180800010_1180800027 25 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800027 22:18627368-18627390 GAAGGGTGGGTTTGGGTCCCTGG No data
1180800010_1180800023 11 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800023 22:18627354-18627376 GGGAAGAGAGTTGTGAAGGGTGG No data
1180800010_1180800021 7 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800021 22:18627350-18627372 GGAGGGGAAGAGAGTTGTGAAGG No data
1180800010_1180800025 17 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800010 Original CRISPR ACAGGGGCCCTCCTGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr