ID: 1180800020

View in Genome Browser
Species Human (GRCh38)
Location 22:18627338-18627360
Sequence TCTTCCCCTCCCAGCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800020_1180800027 7 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800027 22:18627368-18627390 GAAGGGTGGGTTTGGGTCCCTGG No data
1180800020_1180800024 -6 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800024 22:18627355-18627377 GGAAGAGAGTTGTGAAGGGTGGG No data
1180800020_1180800026 0 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800026 22:18627361-18627383 GAGTTGTGAAGGGTGGGTTTGGG No data
1180800020_1180800023 -7 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800023 22:18627354-18627376 GGGAAGAGAGTTGTGAAGGGTGG No data
1180800020_1180800025 -1 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800020_1180800022 -10 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800022 22:18627351-18627373 GAGGGGAAGAGAGTTGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800020 Original CRISPR TCTTCCCCTCCCAGCACCAC AGG (reversed) Intergenic
No off target data available for this crispr