ID: 1180800025

View in Genome Browser
Species Human (GRCh38)
Location 22:18627360-18627382
Sequence AGAGTTGTGAAGGGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800005_1180800025 29 Left 1180800005 22:18627308-18627330 CCATGGGAGGTCCCAGGGGCCAG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800009_1180800025 18 Left 1180800009 22:18627319-18627341 CCCAGGGGCCAGGAGGGCCCCTG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800018_1180800025 1 Left 1180800018 22:18627336-18627358 CCCCTGTGGTGCTGGGAGGGGAA No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800012_1180800025 10 Left 1180800012 22:18627327-18627349 CCAGGAGGGCCCCTGTGGTGCTG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800020_1180800025 -1 Left 1180800020 22:18627338-18627360 CCTGTGGTGCTGGGAGGGGAAGA No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800010_1180800025 17 Left 1180800010 22:18627320-18627342 CCAGGGGCCAGGAGGGCCCCTGT No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data
1180800019_1180800025 0 Left 1180800019 22:18627337-18627359 CCCTGTGGTGCTGGGAGGGGAAG No data
Right 1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800025 Original CRISPR AGAGTTGTGAAGGGTGGGTT TGG Intergenic
No off target data available for this crispr