ID: 1180800098

View in Genome Browser
Species Human (GRCh38)
Location 22:18627693-18627715
Sequence GAGGGTGTGCACAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800098_1180800115 21 Left 1180800098 22:18627693-18627715 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180800115 22:18627737-18627759 GCCTGTGTTTGCAGTGCTACAGG No data
1180800098_1180800117 22 Left 1180800098 22:18627693-18627715 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180800117 22:18627738-18627760 CCTGTGTTTGCAGTGCTACAGGG No data
1180800098_1180800118 25 Left 1180800098 22:18627693-18627715 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180800118 22:18627741-18627763 GTGTTTGCAGTGCTACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800098 Original CRISPR GAGGGTGTGCACAAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr