ID: 1180800568

View in Genome Browser
Species Human (GRCh38)
Location 22:18630037-18630059
Sequence ACACCCTCCCAGCCAGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180800565_1180800568 15 Left 1180800565 22:18629999-18630021 CCTAGAGTAGACTAAGCTGGCCG No data
Right 1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG No data
1180800566_1180800568 -5 Left 1180800566 22:18630019-18630041 CCGCTGCCATGCTAACACACACC No data
Right 1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180800568 Original CRISPR ACACCCTCCCAGCCAGCCGC TGG Intergenic
No off target data available for this crispr