ID: 1180803168

View in Genome Browser
Species Human (GRCh38)
Location 22:18643082-18643104
Sequence ATCCACTGATAATCTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180803168_1180803175 14 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803175 22:18643119-18643141 CCTGCAGGCCAGAAGGTGGTGGG No data
1180803168_1180803169 -1 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803169 22:18643104-18643126 TATTTCAGCAGAAACCCTGCAGG No data
1180803168_1180803173 13 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803173 22:18643118-18643140 CCCTGCAGGCCAGAAGGTGGTGG No data
1180803168_1180803171 10 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803171 22:18643115-18643137 AAACCCTGCAGGCCAGAAGGTGG No data
1180803168_1180803170 7 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803170 22:18643112-18643134 CAGAAACCCTGCAGGCCAGAAGG 0: 6
1: 36
2: 242
3: 867
4: 1320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180803168 Original CRISPR ATCCACTGATAATCTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr