ID: 1180803169

View in Genome Browser
Species Human (GRCh38)
Location 22:18643104-18643126
Sequence TATTTCAGCAGAAACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180803168_1180803169 -1 Left 1180803168 22:18643082-18643104 CCTCTAGAAGATTATCAGTGGAT No data
Right 1180803169 22:18643104-18643126 TATTTCAGCAGAAACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180803169 Original CRISPR TATTTCAGCAGAAACCCTGC AGG Intergenic
No off target data available for this crispr