ID: 1180804113

View in Genome Browser
Species Human (GRCh38)
Location 22:18651272-18651294
Sequence AAGCCCCGGCCTTCCTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180804113_1180804124 13 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804124 22:18651308-18651330 CTGCTGCCAAAGACACTGGGGGG No data
1180804113_1180804119 10 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804119 22:18651305-18651327 GCCCTGCTGCCAAAGACACTGGG No data
1180804113_1180804123 12 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804123 22:18651307-18651329 CCTGCTGCCAAAGACACTGGGGG No data
1180804113_1180804126 24 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804113_1180804121 11 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804121 22:18651306-18651328 CCCTGCTGCCAAAGACACTGGGG No data
1180804113_1180804118 9 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804118 22:18651304-18651326 GGCCCTGCTGCCAAAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180804113 Original CRISPR AAGCCCCGGCCTTCCTGGTG AGG (reversed) Intergenic
No off target data available for this crispr