ID: 1180804120

View in Genome Browser
Species Human (GRCh38)
Location 22:18651306-18651328
Sequence CCCCAGTGTCTTTGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180804120_1180804126 -10 Left 1180804120 22:18651306-18651328 CCCTGCTGCCAAAGACACTGGGG No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804120_1180804131 21 Left 1180804120 22:18651306-18651328 CCCTGCTGCCAAAGACACTGGGG No data
Right 1180804131 22:18651350-18651372 CAGCTGTCTCTCTTGGACTTAGG No data
1180804120_1180804128 14 Left 1180804120 22:18651306-18651328 CCCTGCTGCCAAAGACACTGGGG No data
Right 1180804128 22:18651343-18651365 GCCCTCGCAGCTGTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180804120 Original CRISPR CCCCAGTGTCTTTGGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr