ID: 1180804126

View in Genome Browser
Species Human (GRCh38)
Location 22:18651319-18651341
Sequence GACACTGGGGGGTTTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180804113_1180804126 24 Left 1180804113 22:18651272-18651294 CCTCACCAGGAAGGCCGGGGCTT No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804120_1180804126 -10 Left 1180804120 22:18651306-18651328 CCCTGCTGCCAAAGACACTGGGG No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804117_1180804126 -2 Left 1180804117 22:18651298-18651320 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804114_1180804126 19 Left 1180804114 22:18651277-18651299 CCAGGAAGGCCGGGGCTTCGTCC No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data
1180804116_1180804126 10 Left 1180804116 22:18651286-18651308 CCGGGGCTTCGTCCTCTCGGCCC No data
Right 1180804126 22:18651319-18651341 GACACTGGGGGGTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180804126 Original CRISPR GACACTGGGGGGTTTCTTCC TGG Intergenic
No off target data available for this crispr