ID: 1180806649

View in Genome Browser
Species Human (GRCh38)
Location 22:18718158-18718180
Sequence GACACTGGGGGGTTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180806649_1180806659 10 Left 1180806649 22:18718158-18718180 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180806659 22:18718191-18718213 GGGCCGAGAGGACGAAGCCCCGG No data
1180806649_1180806661 19 Left 1180806649 22:18718158-18718180 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180806661 22:18718200-18718222 GGACGAAGCCCCGGCCTTCCTGG No data
1180806649_1180806662 24 Left 1180806649 22:18718158-18718180 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180806662 22:18718205-18718227 AAGCCCCGGCCTTCCTGGTGAGG No data
1180806649_1180806658 -2 Left 1180806649 22:18718158-18718180 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180806658 22:18718179-18718201 TCTTTGGCAGCAGGGCCGAGAGG No data
1180806649_1180806655 -10 Left 1180806649 22:18718158-18718180 CCAGGAAGAAACCCCCCAGTGTC No data
Right 1180806655 22:18718171-18718193 CCCCAGTGTCTTTGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180806649 Original CRISPR GACACTGGGGGGTTTCTTCC TGG (reversed) Intergenic
No off target data available for this crispr