ID: 1180809841

View in Genome Browser
Species Human (GRCh38)
Location 22:18752092-18752114
Sequence TCCCACCCTAGCTGAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180809841_1180809848 13 Left 1180809841 22:18752092-18752114 CCATGGCTTCAGCTAGGGTGGGA No data
Right 1180809848 22:18752128-18752150 CTCTCTCTAATGACTTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180809841 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG (reversed) Intergenic
No off target data available for this crispr