ID: 1180817070

View in Genome Browser
Species Human (GRCh38)
Location 22:18797189-18797211
Sequence CCTTCTTTGCAGGAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180817070_1180817078 -6 Left 1180817070 22:18797189-18797211 CCATCCATCTCCTGCAAAGAAGG No data
Right 1180817078 22:18797206-18797228 AGAAGGCTGGAGGCAGGTCAGGG No data
1180817070_1180817077 -7 Left 1180817070 22:18797189-18797211 CCATCCATCTCCTGCAAAGAAGG No data
Right 1180817077 22:18797205-18797227 AAGAAGGCTGGAGGCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180817070 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr