ID: 1180819536

View in Genome Browser
Species Human (GRCh38)
Location 22:18816568-18816590
Sequence TATCCAAGGCTTCTAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180819530_1180819536 18 Left 1180819530 22:18816527-18816549 CCACTTTGCCAATCACATCAAGT No data
Right 1180819536 22:18816568-18816590 TATCCAAGGCTTCTAAAGTCTGG No data
1180819533_1180819536 -5 Left 1180819533 22:18816550-18816572 CCAAACTCCGTGTCTTGGTATCC No data
Right 1180819536 22:18816568-18816590 TATCCAAGGCTTCTAAAGTCTGG No data
1180819529_1180819536 27 Left 1180819529 22:18816518-18816540 CCGGAGATTCCACTTTGCCAATC No data
Right 1180819536 22:18816568-18816590 TATCCAAGGCTTCTAAAGTCTGG No data
1180819531_1180819536 10 Left 1180819531 22:18816535-18816557 CCAATCACATCAAGTCCAAACTC No data
Right 1180819536 22:18816568-18816590 TATCCAAGGCTTCTAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180819536 Original CRISPR TATCCAAGGCTTCTAAAGTC TGG Intergenic
No off target data available for this crispr