ID: 1180820318

View in Genome Browser
Species Human (GRCh38)
Location 22:18822688-18822710
Sequence GAACCAAGGTGACGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180820314_1180820318 -1 Left 1180820314 22:18822666-18822688 CCCACAGGTGAATCTTAATTATG No data
Right 1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG No data
1180820315_1180820318 -2 Left 1180820315 22:18822667-18822689 CCACAGGTGAATCTTAATTATGA No data
Right 1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG No data
1180820313_1180820318 7 Left 1180820313 22:18822658-18822680 CCACGTCACCCACAGGTGAATCT No data
Right 1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG No data
1180820312_1180820318 8 Left 1180820312 22:18822657-18822679 CCCACGTCACCCACAGGTGAATC No data
Right 1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG No data
1180820310_1180820318 27 Left 1180820310 22:18822638-18822660 CCATGGGCTGCAAGTGGGTCCCA No data
Right 1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180820318 Original CRISPR GAACCAAGGTGACGGCAGAG AGG Intergenic
No off target data available for this crispr