ID: 1180821726

View in Genome Browser
Species Human (GRCh38)
Location 22:18833546-18833568
Sequence CTCCGAGGCGTCGCCCGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821726_1180821740 18 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821740 22:18833587-18833609 GGTGCTGGGCCCTTGGAAATCGG No data
1180821726_1180821732 -3 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821732 22:18833566-18833588 GAGGAGGCCGCGGACCCCTTAGG No data
1180821726_1180821741 25 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821741 22:18833594-18833616 GGCCCTTGGAAATCGGCGCGTGG No data
1180821726_1180821735 4 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821735 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
1180821726_1180821733 3 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821733 22:18833572-18833594 GCCGCGGACCCCTTAGGTGCTGG No data
1180821726_1180821737 11 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821737 22:18833580-18833602 CCCCTTAGGTGCTGGGCCCTTGG No data
1180821726_1180821744 27 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821744 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
1180821726_1180821747 29 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821726_1180821742 26 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821742 22:18833595-18833617 GCCCTTGGAAATCGGCGCGTGGG No data
1180821726_1180821746 28 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG No data
Right 1180821746 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821726 Original CRISPR CTCCGAGGCGTCGCCCGGCT AGG (reversed) Intergenic