ID: 1180821731

View in Genome Browser
Species Human (GRCh38)
Location 22:18833561-18833583
Sequence GGGGTCCGCGGCCTCCTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821731_1180821737 -4 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821737 22:18833580-18833602 CCCCTTAGGTGCTGGGCCCTTGG No data
1180821731_1180821744 12 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821744 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
1180821731_1180821746 13 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821746 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
1180821731_1180821742 11 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821742 22:18833595-18833617 GCCCTTGGAAATCGGCGCGTGGG No data
1180821731_1180821748 17 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821731_1180821741 10 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821741 22:18833594-18833616 GGCCCTTGGAAATCGGCGCGTGG No data
1180821731_1180821740 3 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821740 22:18833587-18833609 GGTGCTGGGCCCTTGGAAATCGG No data
1180821731_1180821747 14 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821731 Original CRISPR GGGGTCCGCGGCCTCCTCCG AGG (reversed) Intergenic